Indan Journal of Medical Research Indan Journal of Medical Research Indan Journal of Medical Research
  Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login  
  Home Print this page Email this page Small font sizeDefault font sizeIncrease font size Users Online: 507       

   Table of Contents      
CORRESPONDENCE
Year : 2016  |  Volume : 143  |  Issue : 4  |  Page : 514-517

Fatal infection in adults by pneumolysin & autolysin producing, non-vaccine serotype Streptococcus pneumonia


1 Department of Clinical Microbiology, Pondicherry Institute of Medical Sciences, Puducherry 605 014, India
2 Department of Medicine, Pondicherry Institute of Medical Sciences, Puducherry 605 014, India
3 Department of Biotechnology, Pondicherry University, Puducherry 605 014, India

Date of Web Publication21-Jun-2016

Correspondence Address:
Reba Kanungo
Department of Clinical Microbiology, Pondicherry Institute of Medical Sciences, Puducherry 605 014
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0971-5916.184307

Rights and Permissions

How to cite this article:
Kanungo R, Anandhalakshmi S, Sheeladevi C, Sudhagar M, John J, Prashanth K. Fatal infection in adults by pneumolysin & autolysin producing, non-vaccine serotype Streptococcus pneumonia. Indian J Med Res 2016;143:514-7

How to cite this URL:
Kanungo R, Anandhalakshmi S, Sheeladevi C, Sudhagar M, John J, Prashanth K. Fatal infection in adults by pneumolysin & autolysin producing, non-vaccine serotype Streptococcus pneumonia. Indian J Med Res [serial online] 2016 [cited 2021 Jun 17];143:514-7. Available from: https://www.ijmr.org.in/text.asp?2016/143/4/514/184307



Sir,

Despite variable levels of antibiotic resistance in clinical isolates of Streptococcus pneumoniae reported from India, invasive pneumococcal infection continues to pose a challenge in children[1]. It is a paradox that the susceptibility of pneumococci to antibiotics is not as major a problem as it is observed with staphylococci, enterococci and the Gram-negative bacteria, though outcome of some of the pneumococcal infections are fatal[2]. Rapidly progressive disease in the vulnerable population namely, the very young and the elderly is a challenge to the treating physician, a factor which is compounded by lack of confirmatory diagnosis due to poor laboratory support. Sporadic reports of adult pneumococcal infections have been documented[3]. Factors predisposing this group to fatal pneumococcal infection are unknown[4]. Vaccination of the adult population is limited to the very elderly and those with risk of underlying immunosuppression and splenectomized persons[5]. We encountered two cases of invasive pneumococcal infections in adult patients with progressive illness with a fatal outcome in a tertiary care centre in south India during 2012. An attempt was made to detect virulence genes coding for pneumolysin (ply) and autolysin (lytA), as these two antigens are known to be associated with virulence of S. pneumoniae in experimental animals[6].

The first case was a 72 years old male with loss of consciousness for 12 h, brought to the emergency unit of Pondicherry Institute of Medical Sciences, Puducherry, India. He had no history of fever, breathlessness or seizures. He did not have any known risk factors. At admission he had respiratory distress and was transferred to the intensive care unit (ICU) for intubation. Chest X- ray showed bilateral infiltrates with pneumothorax on the left side. Computed tomography (CT) of the brain revealed dilated ventricles. Initial laboratory investigations revealed the following values: total WBC count of 9800/mm3, differential count of 89 per cent neutrophils, 8 per cent lymphocytes and 3 per cent monocytes. A preliminary diagnosis of sepsis with pneumonia and pyogenic meningitis was made. He was started empirically on cefoperazone sulbactam, metronidazole and doxycycline (due to the area being endemic for scrub typhus). Subsequently, blood and CSF cultures grew S. pneumoniae (IBT 1960) (serotyped as 33C- Pneumotest- Statens Serum Institute, Solna, Sweden), which was susceptible to ampicillin, penicillin (by oxacillin screen), ceftriaxone, cefotaxime and vancomycin. Following the culture report antibiotics were changed to vancomycin and ampicillin. He developed hypotension and shock, and despite ventilatory support, administration of intravenous fluids, antibiotics and vassopressor agents his condition deteriorated and he died within 48 h of admission.

The second case was a 47 year old male who was conscious but restless and disoriented, and was brought to the casualty of this hospital. There was history of fever and shortness of breath for two weeks, cough for one week and chest pain for two days. There was no other co-morbid condition. Chest X-ray revealed right lower lobe consolidation. Complete blood count revealed total WBC count to be 24000/mm3 and a differential count suggestive of pyogenic infection (95% neutrophils,

4% lymphocytes, 1% monocytes). A diagnosis of right lower lobe pneumonia associated with acute respiratory distress syndrome, sepsis and multi-organ dysfunctional syndrome was made. He was empirically started on linezolid, imipenem and piperacillin-tazobactam. Sepsis was confirmed by a positive blood culture for S. pneumoniae (IBT -1975; serotype 7C), which was sensitive to penicillin, ciprofloxacin, ceftriaxone, erythromycin, gentamicin and vancomycin. The patient was continued with linezolid, imipenem while azithromycin was added. His condition continued to deteriorate and he succumbed to the infection within 72 h of admission.

The two isolates were further tested for the presence of different virulence determinants such as genes encoding for pneumolysin (ply), autolysin (lytA) and to document presence of virulence factors and penicillin binding protein (pbpA)[7]. The primer details are given below: lytA (size 319 bp)[4] forward primer F-5'AACCGTACAGAATGAAGCGG-3' and reverse primer R-5' TATTCGTGCAATACTCGTGCG-3'; ply (size 348 bp) forward primer F- 5'ATTTCTGTAACAGCTACCAACGA3' and reverse primer R- 5'GAATTCCCTGTCTTTTCAAAGTC3'; pbpA (size-789 bp) forward primer F-5'CCGTATCCTGGGAGCTTTCTT-3' and reverse primer R-5'-TCGCGGTTTGTTTCTACTGC-3'. All primers used in the study were designed using GeneTool software and custom synthesize by Eurofins (Bengaluru, India), used in previously described study[7]. All three genes were detected in both the isolates ([Figure 1]).
Figure 1: Pneumolysin (ply), autolysin (lytA) and modified penicillin binding protein (pbpA) genes amplified in the two isolates from cases of fatal pneumococcal infection. Amplicon sizes : ply - 348 bp; lytA - 319 bp and pbpA - 789 bp. M - 100 bp ladder (Gene ruler); Lanes 1, 5, 9; IBT-1960 (serotype 33C); Lanes 2, 6 ,10 - IBT -1975 (serotype 7C) and Lanes 3,7,11 - S. pneumoniae ATCC 49619; Lanes 4, 8, negative control.

Click here to view


Rapidly fatal pneumococcal disease is known to occur in immunocompromised individuals, splenectomized individuals and HIV infected patients are at increased risk of developing severe pneumococcal disease8,9. Fatal outcome in the immunocompetent patients have been infrequently reported in literature[10]. Rapidly progressing pneumococcal sepsis with metabolic acidosis and disseminated intravascular coagulation has been reported in two adult individuals by Iinuma et al[3].

Analysis of the isolates revealed two interesting observations. Both the isolates that were responsible for fatal outcome belonged to non-vaccine serotypes i.e. 33C and 7C. The capsular polysaccharide-23 valent vaccine used for adult vaccination does not contain these two serotypes[11],[12]. Studies in the West have shown that infections due to vaccine serotypes have declined in adults following vaccination of children with PCV-7 while non-vaccine serotypes causing invasive infections in high risk adults has risen[13],[14],[15]. In India, where pneumococcal vaccines have not been included in the routine immunization schedule in children, and adult vaccination is sporadic, and serotyping of invasive isolates remains a challenge. Routine typing to know the incidence of infections due to vaccine or non-vaccine serotypes both in children and adults, is not undertaken by most clinical laboratories across the country. Fatal infections caused by non-23 valent vaccine serotypes such as 33C and 7C of S. pneumoniae observed in this study raise the question on current strategies of adult pneumococcal vaccination. As the patients were healthy adults, preventive vaccination would not have played a role in protecting these individuals.

Pathogenesis of invasive pneumococcal disease depends on both host inflammatory response as well as the organism's virulence. Several virulence factors have been incriminated in the pathogenesis of pneumococcal disease, including autolysin, pneumolysin (a key inducer of apoptosis) and pneumococcal surface adhesin A (PsaA)[16]. Capsular polysaccharide is the most commonly attributed factor. pneumolysin is a cholesterol dependent cytolysin, that binds to cells and induces apoptosis[17]. Pneumolysin is known to reduce ciliary action, phagocytic function of polymorphonuclear cells and induce acute inflammatory reaction[18]. Both the isolates in this study were positive for genes coding for autolysin and pneumolysin. though pbp gene was detected, penicillin resistance was not detected phenotypically, suggesting non-phenotypic expression of the gene.

Our observation highlights two points. First, the involvement of non-vaccine serotypes in fatal invasive pneumococcal infection in adults. Some studies have shown a decline in adult pneumococcal disease following introduction of multi-valent pneumococcal conjugate vaccine in children13,18. But adult invasive infection and protecting the high risk groups still remains a major problem in several countries[19]. The US advisory committee on invasive pneumococcal disease (ACIP) has recommended the use of 23 valent polysaccharide vaccine (PPSV23) and the PCV13 (conjugate vaccine) for use in the elderly population aged >65 yr7,20. Secondly, could presence of pneumolysin and autolysin genes in the isolates obtained from these patients have any diagnostic or prognostic indications? Severity of pneumococcal pneumonia associated with bacterial genomic load determined by the copies of lytA genes has been reported[21].

In patients with no underlying risk factors, a strong suspicion of invasive pneumococcal disease with rapid assessment needs to be done to prevent grave outcome. A delay in treatment can occur in young and middle-aged patients, who are otherwise healthy leading to serious consequence. Accurate management in a timely manner can improve outcome. Rapid laboratory tests are essential for confirmatory diagnosis. A rapid diagnostic tool has been developed to detect pneumococcal antigen in urine and other body fluids which shows high sensitivity and specificity in adults19. The two isolates from our patients had the lytA and ply genes, although we did not attempt to detect this from the patients' blood or body fluids. high level of clinical suscpicion with laboratory support by conventional blood culture, effective case management with appropriate antibiotics will decrease morbidity and mortality due to invasive pneumococcal disease in adults.

Acknowledgment

The authors thank Dr K.L. Ravikumar, Principal Investigator- PIDOPS STUDY KIMS Hospital and Research Centre, Bengaluru for serotyping the isolates.

Conflicts of Interest:

None.

 
   References Top

1.
Kumar KLR, Ganaie F, Ashok V. Circulating serotypes and trends in antibiotic resistance of invasive Streptococcus pneumoniae from children under five in Bangalore. J Clin Diagn Res 2013; 7 : 2716-20.   Back to cited text no. 1
    
2.
Thomas K, MukkaiKesavan L, Veeraraghavan B, Jasmine S, Jude J, Shubankar M, et al. Invasive pneumococcal disease associated with high case fatality in India. J Clin Epidemiol 2013; 66: 36-43.   Back to cited text no. 2
    
3.
Iinuma Y, Hirose Y, Tanaka T, Kumagai K, Miyajima M, Sekiguchi H, et al. Rapidly progressive fatal pneumococcal sepsis in adults: a report of two cases. J Infect Chemother 2007; 13 : 346-9.   Back to cited text no. 3
    
4.
Bogaert D, de Groot R, Hermans PWM. Streptococcus pneumoniae colonisation: the key to pneumococcal disease. Lancet Infect Dis 2004; 4 : 145-54.  Back to cited text no. 4
    
5.
Prevention of pneumococcal disease: recommendations of the Advisory Committee on Immunization Practices (ACIP). MMWR Recomm Rep 1997; 46 : 1.   Back to cited text no. 5
    
6.
Seki M, Yamashita Y, Torigoe H, Tsuda H, Sato S, Maeno M. Loop-mediated isothermal amplification method targeting the lytA gene for detection of Streptococcus pneumoniae. J Clin Microbiol 2005; 43 : 1581-6.  Back to cited text no. 6
    
7.
Sourav S, Patricia A, Sharma S, Kanungo R, Jayachandran S, Prashanth K. Detection of pneumolysin and autolysin genes among antibiotic resistant Streptococcus pneumoniae in invasive infections. Indian J Med Microbiol 2010; 28 : 34-9.  Back to cited text no. 7
    
8.
Pilishvili T, Bennett NM. Pneumococcal disease prevention among adults: Strategies for the use of pneumococcal vaccines. Am J Prev Med 2015; 49 (Suppl 4): D60-5.   Back to cited text no. 8
    
9.
Albrich WC, Madhi SA, Adrian PV, van Niekerk N, Telles JN, Ebrahim N, et al. Pneumococcal colonisation density: a new marker for disease severity in HIV-infected adults with pneumonia. BMJ Open 2014; 4 : e005953.   Back to cited text no. 9
    
10.
Peters MN, Hesterman KS, Katz MJ, Barnes MB, Brown RR, Nijjar VS, et al. Primary Streptococcus pneumoniae pericarditis. Proc (Bayl Univ Med Cent) 2013; 26 : 35-8.  Back to cited text no. 10
    
11.
Butler JC, Breiman RF, Campbell JF, Lipman HB, Broome CV, Facklam RR. Pneumococcal polysaccharide vaccine efficacy: an evaluation of current recommendations. JAMA 1993; 270 : 1826-31.  Back to cited text no. 11
    
12.
Butler JC, Breiman RF, Lipman HB, Hofmann J, Facklam RR. Serotype distribution of Streptococcus pneumoniae infections among preschool children in the United States, 1978-1994: Implications for development of a conjugate vaccine. J Infect Dis 1995; 171 : 885-9.  Back to cited text no. 12
    
13.
Muhammad RD, Oza-Frank R, Zell E, Link-Gelles R, Narayan KM, Schaffner W, et al. Epidemiology of invasive pneumococcal disease among high-risk adults since the introduction of pneumococcal conjugate vaccine for children. Clin Infect Dis 2013; 56 : 59-67.   Back to cited text no. 13
    
14.
Pilishvili T, Lexau C, Farley MM, Hadler J, Harrison LH, Bennettet NM, et al. Sustained reductions in invasive pneumococcal disease in the era of conjugate vaccine. J Infect Dis 2010; 201 : 32-41.  Back to cited text no. 14
    
15.
Singleton RJ, Hennessy TW, Bulkow LR, Hammitt LL, Zulz T, Hurlburt DA, et al. Invasive pneumococcal disease caused by nonvaccine serotypes among Alaska native children with high levels of 7-valent pneumococcal conjugate vaccine coverage. JAMA 2007; 297 : 1784-92.  Back to cited text no. 15
    
16.
Littmann M, Albiger B, Frentzen A, Normark S, Henriques-Normark B, Plant L. Streptococcus pneumoniae evades human dendritic cell surveillance by pneumolysin expression. EMBO Mol Med 2009; 1 : 211-22.   Back to cited text no. 16
    
17.
Joshua V, Pirofski L. Current concepts in host-microbe interaction leading to pneumococcal pneumonia. Curr Opin Infect Dis 2013; 26 : 277-83.   Back to cited text no. 17
    
18.
Musher DM, Phan HM, Baughn RE . Protection against bacteremic pneumococcal infection by antibody to pneumolysin. J Infect Dis 2001; 183: 827-30.  Back to cited text no. 18
    
19.
Lexau CA, Lynfield R, Danila R, Pilishvili T, Facklam R, Farley MM, et al. Changing epidemiology of invasive pneumococcal disease among older adults in the era of pediatric pneumococcal conjugate vaccine. JAMA 2005; 294 : 2043-51.  Back to cited text no. 19
    
20.
Ludwig E, Bonanni P, Rohde G, Sayiner A, Torres A. The remaining challenges of pneumococcal disease in adults. Eur Res Rev 2012; 21 : 57-65.  Back to cited text no. 20
    
21.
Rello J, Lisboa T, Lujan MG, Kee CWH, Kay I, Lopez D, et al. Severity of pneumococcal pneumonia associated with genomic bacterial load. Chest 2009; 136 : 832-40.  Back to cited text no. 21
    


    Figures

  [Figure 1]



 

Top
 
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
    References
    Article Figures

 Article Access Statistics
    Viewed1046    
    Printed2    
    Emailed0    
    PDF Downloaded318    
    Comments [Add]    

Recommend this journal