Indan Journal of Medical Research Indan Journal of Medical Research Indan Journal of Medical Research Indan Journal of Medical Research
  Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login  
  Home Print this page Email this page Small font sizeDefault font sizeIncrease font size Users Online: 983       

   Table of Contents      
ORIGINAL ARTICLE
Year : 2019  |  Volume : 149  |  Issue : 2  |  Page : 281-284

CTX-M type extended-spectrum β-lactamase in Escherichia coli isolated from extra-intestinal infections in a tertiary care hospital in south India


1 Department of Microbiology, The Madras Medical Mission, Chennai, India
2 Division of Infectious Diseases, Nitte University Centre for Science Education & Research, Mangaluru, India
3 Department of Microbiology, K.S. Hegde Medical Academy, Mangaluru, India
4 Department of Nephrology, The Madras Medical Mission, Chennai, India
5 Nitte (Deemed to be University), Mangaluru, India
6 Nitte University Centre for Science Education & Research, Mangaluru, India

Date of Submission31-Dec-2017
Date of Web Publication3-Jun-2019

Correspondence Address:
Dr Indrani Karunasagar
Nitte Centre for Science Education & Research, Kotekar-Beeri Road, Paneer Campus, Deralakatte, Mangalore 575 018, Karnataka
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ijmr.IJMR_2099_17

Rights and Permissions
   Abstract 

Background & objectives: Infections caused by extended-spectrum β-lactamase (ESBL)-producing Escherichia coli carrying blaCTX-M genes have been spreading globally, but there are geographical variations in the type of blaCTX-Mgenes prevalent and there are scanty data from India. This study was conducted to determine the CTX-M type ESBLs in E. coli isolates obtained from clinical specimens from patients with extra-intestinal infections attending a tertiary care hospital in south India.
Methods: ESBL-producing E. coli isolated from patients with extra-intestinal infections were subjected to PCR using CTX-M group-specific primers. From a representative isolate, full-length CTX-M-15 gene was amplified and sequenced. An internal fragment of this gene was sequenced in 10 representative isolates.
Results: Of the 300 isolates of E. coli tested, 88 per cent carried CTX-M genes and blaCTX-M-15was the most dominant gene present in 90 per cent of the positive isolates. Most (91%) of the isolates positive for blaCTX-M were sensitive to meropenem.
Interpretation & conclusions: Our findings showed blaCTX-M-15 to be the dominant gene. Based on the data on antimicrobial susceptibility, cefoperazone-sulbactum could be an antimicrobial of choice.

Keywords: CTX-M - Escherichia coli - extended-spectrum β-lactamase - molecular epidemiology


How to cite this article:
Rohit A, Deekshit VK, Balaraj M, Alandur VS, Abraham G, Karunasagar I, Karunasagar I. CTX-M type extended-spectrum β-lactamase in Escherichia coli isolated from extra-intestinal infections in a tertiary care hospital in south India. Indian J Med Res 2019;149:281-4

How to cite this URL:
Rohit A, Deekshit VK, Balaraj M, Alandur VS, Abraham G, Karunasagar I, Karunasagar I. CTX-M type extended-spectrum β-lactamase in Escherichia coli isolated from extra-intestinal infections in a tertiary care hospital in south India. Indian J Med Res [serial online] 2019 [cited 2019 Jun 18];149:281-4. Available from: http://www.ijmr.org.in/text.asp?2019/149/2/281/259592

Extended-spectrum β-lactamases (ESBLs) are the most prevalent type of antimicrobial resistance mechanisms among Enterobacteriaceae such as  Escherichia More Details coli and Klebsiella pneumoniae[1]. There are over 200 enzymes characterized to be in the ESBL spectrum, which are encoded by plasmid or chromosomally carried genes [1]. Several studies indicate that CTX-M-type ESBLs are spreading globally and becoming dominant types in Enterobacteriaceae in many countries [2],[3]. However, the diversity of CTX-M types occurring in India is yet to be fully understood. There are only a few reports of molecular identification of β-lactamases. For example, a few studies indicated that CTX-M-15 could be the predominant ESBL in northern India [4],[5]. Report from south India [5],[6] has indicated the prevalence of CTX-M-1-type gene in 58.3 per cent of Klebsiella spp. and in 36 per cent of E. coli. This study was undertaken to estimate the presence of CTX-M type ESBLs in E. coli isolated from samples of extra-intestinal infections in patients attending a tertiary care hospital in south India.


   Material & Methods Top


Three hundred isolates of E. coli obtained from urine, wound swab, sputum, pus, endotracheal secretions, bronchoalveolar lavage, bile fluids and other fluids from sterile body sites such as pleural fluid, bile, peritoneal fluid and blood cultures were collected over two and a half years (2013-2016) in the Microbiology department of The Madras Medical Mission, a tertiary care hospital in Chennai, India. Standard clinical microbiological procedures were used for the isolation of E. coli[7] and identification was done through VITEK II compact (BioMérieux, France). Antimicrobial susceptibility testing was done in Mueller-Hinton agar according to the current Clinical and Laboratory Standards Institute (CLSI) guidelines [8],[9],[10],[11].

Phenotypic testing for ESBLs: ESBL phenotypic screening was performed for all the isolates by the double-disk diffusion test using ceftazidime (30 μg) and ceftazidime/clavulanic acid [8],[9],[10],[11]. E. coli ATCC 25922 and E. coli ATCC BAA-2326 were used as the negative and positive controls and the zone diameter interpreted as per the CLSI M-100 recommended guidelines [8],[9],[10],[11]. ESBL phenotypic confirmatory test was performed by the double-disk diffusion method using antibiotic disks containing a combination of cephalosporin plus clavulanic acid in combination with a corresponding cephalosporin disk alone [8],[9],[10],[11].

Storage of isolates: Isolates were transferred to semisolid agar and stored at −20°C. For long-term storage, cultures were suspended in Luria-Bertani (LB) broth (Himedia, India) with 30 per cent glycerol and stored at −80°C.

Molecular testing for CTX-M: As per the antibiogram analyzed over 2013 to 2016 the rate of ESBL-positive organisms was 70-80 per cent among various isolates from The Madras Medical Mission. All isolates were subjected to (PCR) using four sets of primers and PCR conditions described earlier for CTX-M groups [12].

Sequencing of β-lactamase gene from a typical strain: To amplify the entire β-lactamase gene of Group I (CTX-M-15), the sequence from E. coli strain KS127 (accession number AB976567.1) was accessed from GenBank (https://www.ncbi.nlm.nih.gov/nuccore/AB976567). Primer design was based on primer search using NCBI Primer BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). The annealing temperature used for amplification was 55°C. An isolate of E. coli, IRU1638, recovered from a patient with urinary tract infection was used to sequence the β-lactamase gene.

Sequencing internal region of β-lactamase of a few representative isolates: Ten representative isolates were selected based on source of isolation (7 urine, 2 blood and 1 bile fluid) and varying antibiogram for sequencing of internal region of blaCTX-M-15. The forward primer 5'ACGTTAAACACCGCCATTCC3' and the reverse primer 5'TCGGTGACGATTTTAGCCGC3' amplified a 356 bp fragment of the CTX-M-15 β-lactamase gene. PCR products obtained at 56°C were sequenced by Eurofins, Bengaluru, and the sequence was subjected to nucleotide BLAST search.


   Results & Discussion Top


Of the 300 isolates tested, 238 (79.3%) were positive for Group I CTX-M-15 [Table 1], and of these, majority 174 (73.1%) were urine isolates. Group IV had eight isolates and Group II and III had only one isolate each. Seventeen isolates showed mixed reactions, nine being positive for both Groups I and II, four with both Groups I and III and three isolates with Groups I and IV [Table 1]. Urine isolates accounted for 73 per cent of CTX-M Group I, while among CTX-M-negative isolates, urine accounted for 63 per cent [Table 1]. In a study of 140 Enterobacteriaceae ESBL producers from eastern India [13], the most common gene was blaTEM(96.42%) followed by blaCTX-M(75%) and blaSHV(17.85%). Another study from Central India [14] found that among the 526 urinary isolates of E. coli, the most common resistance gene detected was blaTEM(48.7%) followed by blaCTX-M(7.6%). Our study showed that 88 per cent of the E. coli isolated from extra-intestinal infections carried blaCTX-M[Table 1]. This finding was similar to a study from Chennai [15] which looked at E. coli in HIV patients and detected blaCTX-M in 70.2 per cent of the isolates.
Table 1: Prevalence of different groups of blaCTX-M in different clinical isolates of Escherichia coli

Click here to view


Our study also demonstrated that blaCTX-M Group I was the dominant group among extra-intestinal E. coli isolates. A study from Korea [16] noted that of the 80 blaCTX-Mcarrying extra-intestinal E. coli studied, 36 carried blaCTX-M-15 (Group I), while 46 carried blaCTX-M-14(Group IV). Predominance of Group IV over Group I has also been reported from China [17]. Among 201 E. coli isolates studied from Shandong Province in China, 116 (57.7%) carried blaCTX-M-14(Group IV) and only 31 (15.4%) carried blaCTX-M-15(Group I). In river water in India, blaCTX-M15 accounted for 46 per cent of isolates while 32 per cent isolates were positive for blaTEM[18].

The antibiogram pattern of isolates positive and negative for blaCTX-M is indicated in [Table 2]. CTX-M-positive isolates showed lesser sensitivity to clavulanic acid (7%) in comparison to sulbactam (62%) and tazobactam (55%). Majority (91%) of blaCTX-M-positive isolates showed meropenem sensitivity compared to those negative for this gene (72%).
Table 2: Comparison of sensitivity of isolates positive for blaCTX-M and those negative for this gene

Click here to view


The full-length blaCTX-M-15 was amplified and sequenced in one typical isolate and a 356 bp internal fragment was amplified and sequenced in 10 isolates. BLAST analysis showed that these sequences had 100 per cent similarity to blaCTX-M-15from E. coli and Klebsiella spp. in GenBank. These data confirmed the results obtained with group-specific primers. To conclude, the most common type of ESBL in this small single-centre study was identified to be CTX-M-15. Cefoperazone-sulbactam may be a better choice than piperacillin-tazobactam in our setting. Further studies need to be done on a large number of isolates in different parts of the country.

Acknowledgment: Infrastructure support from the Madras Medical Mission is gratefully acknowledged.

Financial support & sponsorship: Authors acknowledge the financial support received from the Indian Council of Medical Research, New Delhi (Grant No. AMR/37/2011-ECD-I).

Conflicts of Interest: None.



 
   References Top

1.
Paterson DL, Bonomo RA. Extended-spectrum beta-lactamases: A clinical update. Clin Microbiol Rev 2005; 18 : 657-86.  Back to cited text no. 1
    
2.
Cantón R, González-Alba JM, Galán JC. CTX-M Enzymes: Origin and Diffusion. Front Microbiol 2012; 3 : 110.  Back to cited text no. 2
    
3.
Doi Y, Iovleva A, Bonomo RA. The ecology of extended-spectrum β-lactamases (ESBLs) in the developed world. J Travel Med 2017; 24 (Suppl 1): S44-51.  Back to cited text no. 3
    
4.
Karim A, Poirel L, Nagarajan S, Nordmann P. Plasmid-mediated extended-spectrum beta-lactamase (CTX-M-3 like) from India and gene association with insertion sequence ISEcp1. FEMS Microbiol Lett 2001; 201 : 237-41.  Back to cited text no. 4
    
5.
Khurana S, Taneja N, Sharma M. Extended spectrum beta-lactamase mediated resistance in urinary tract isolates of family Enterobacteriaceae. Indian J Med Res 2002; 116 : 145-9.  Back to cited text no. 5
    
6.
Jemima SA, Verghese S. Molecular characterization of nosocomial CTX-M type beta-lactamase producing Enterobacteriaceae from a tertiary care hospital in South India. Indian J Med Microbiol 2008; 26 : 365-8.  Back to cited text no. 6
    
7.
Koneman EW, editor. Koneman's color atlas and textbook of diagnostic microbiology. Philadelphia: Lippincott Williams & Wilkins 2006.  Back to cited text no. 7
    
8.
Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; 23rd informational supplement. CLSI Document M100-S23. Wayne, PA: CLSI; 2013.  Back to cited text no. 8
    
9.
Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; 24th informational supplement. CLSI Document M100-S24. Wayne, PA: CLSI; 2014.  Back to cited text no. 9
    
10.
Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; 25th informational supplement. CLSI Document M100-S25. Wayne, PA: CLSI; 2015.  Back to cited text no. 10
    
11.
Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing. 26th ed. CLSI Document M100S. Wayne, PA: CLSI; 2016.  Back to cited text no. 11
    
12.
Pitout JD, Hossain A, Hanson ND. Phenotypic and molecular detection of CTX-M-beta-lactamases produced by Escherichia coli and Klebsiella spp. J Clin Microbiol 2004; 42 : 5715-21.  Back to cited text no. 12
    
13.
Jena J, Debata NK, Sahoo RK, Gaur M, Subudhi E. Molecular characterization of extended spectrum β-lactamase-producing Enterobacteriaceae strains isolated from a tertiary care hospital. Microb Pathog 2018; 115 : 112-6.  Back to cited text no. 13
    
14.
Bajpai T, Pandey M, Varma M, Bhatambare GS. Prevalence of TEM, SHV, and CTX-M beta-lactamase genes in the urinary isolates of a tertiary care hospital. Avicenna J Med 2017; 7 : 12-6.  Back to cited text no. 14
    
15.
Padmavathy K, Padma K, Rajasekaran S. Multidrug resistant CTX-M-producing Escherichia coli: A growing threat among HIV patients in India. J Pathog 2016; 2016 : 4152704.  Back to cited text no. 15
    
16.
Kim S, Sung JY, Cho HH, Kwon KC, Koo SH. Characteristics of the molecular epidemiology of CTX-M-producing Escherichia coli isolated from a tertiary hospital in Daejeon, Korea. J Microbiol Biotechnol 2016; 26 : 1643-9.  Back to cited text no. 16
    
17.
Miao Z, Li S, Wang L, Song W, Zhou Y. Antimicrobial resistance and molecular epidemiology of ESBL-producing Escherichia coli isolated from outpatients in town hospitals of Shandong province, China. Front Microbiol 2017; 8 : 63.  Back to cited text no. 17
    
18.
Dhawde R, Macaden R, Saranath D, Nilgiriwala K, Ghadge A, Birdi T, et al. Antibiotic resistance characterization of environmental E. coli isolated from river Mula-Mutha, Pune district, India. Int J Environ Res Public Health 2018; 15. pii: E1247.  Back to cited text no. 18
    



 
 
    Tables

  [Table 1], [Table 2]



 

Top
 
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
    Abstract
    Material & M...
    Results & Di...
    References
    Article Tables

 Article Access Statistics
    Viewed66    
    Printed0    
    Emailed0    
    PDF Downloaded33    
    Comments [Add]    

Recommend this journal