Indan Journal of Medical Research Indan Journal of Medical Research Indan Journal of Medical Research Indan Journal of Medical Research
  Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login  
  Home Print this page Email this page Small font sizeDefault font sizeIncrease font size Users Online: 1938       

   Table of Contents      
ORIGINAL ARTICLE
Year : 2018  |  Volume : 147  |  Issue : 5  |  Page : 507-512

Molecular characterization of hepatitis A virus from children hospitalized at a tertiary care centre in northwest India


1 Advanced Basic Sciences & Clinical Research Laboratory, Department of Microbiology & Immunology, Sawai Man Singh Medical College, Jaipur, India
2 School of Life & Basic Sciences, Jaipur National University, Jaipur, India

Date of Submission08-Dec-2015
Date of Web Publication1-Aug-2018

Correspondence Address:
Dr Bharti Malhotra
Advanced Basic Sciences & Clinical Research Laboratory, Department of Microbiology & Immunology, SMS Medical College, Jawahar Lal Nehru Marg, Jaipur 302 004, Rajasthan
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ijmr.IJMR_1910_15

Rights and Permissions
   Abstract 

Background & objectives: Hepatitis A virus (HAV) infection is a major cause of childhood hepatitis, prevalent worldwide. HAV is classified into seven genotypes I-VII; genotypes III and I are the most common among humans. The present work was carried out to identify the genotypes prevalent in children suspected to have acute viral hepatitis (AVH), hospitalized at a tertiary care centre in northwest India.
Methods: A total of 1269 blood samples from children (0-15 yr of age) clinically suspected of viral hepatitis were screened for anti-HAV IgM. Acute phase serum was processed for RNA extraction and amplified by nested polymerase chain reaction (PCR) followed by sequencing of representative samples.
Results: Among the 1269 samples tested, 642 (50.59%) were positive for anti-HAV IgM; among the positive samples, 171 patients having a history of less than seven days were tested by PCR, of whom 141 (82.45%) were found to be PCR positive. Nucleotide sequencing of a representative 44 samples showed high homology; all the samples were found to be of genotype IIIA.
Interpretation & conclusions: Hepatitis A was prevalent during July to September and in predominantly children less than five years age. Only genotype IIIA was detected in all the samples.

Keywords: Genotyping - HAV - hepatitis A - phylogenetic analysis - polymerase chain reaction - serology


How to cite this article:
Malhotra B, Kanwar A, Reddy PV, Chauhan A, Tiwari J, Bhargava S, Verma H N. Molecular characterization of hepatitis A virus from children hospitalized at a tertiary care centre in northwest India. Indian J Med Res 2018;147:507-12

How to cite this URL:
Malhotra B, Kanwar A, Reddy PV, Chauhan A, Tiwari J, Bhargava S, Verma H N. Molecular characterization of hepatitis A virus from children hospitalized at a tertiary care centre in northwest India. Indian J Med Res [serial online] 2018 [cited 2019 Oct 18];147:507-12. Available from: http://www.ijmr.org.in/text.asp?2018/147/5/507/238239

Hepatitis is a major health problem in both developing and developed countries. An estimated 1.4 million clinical cases of hepatitis A occur worldwide every year[1]. Hepatitis A occurs sporadically and also as outbreaks. Outbreaks of hepatitis A virus (HAV) have been reported from different States of India with varying positivity of 37.7-100 per cent (HAV- IgM) from Kerala (37.7-87%), Himachal Pradesh (63%) and Tamil Nadu (100%)[2],[3],[4].

Ninety per cent of children are exposed to HAV by the age of five years, and almost all by adolescence[1], majority of hepatitis A patients recover completely and fatality rate is low. The estimated mortality rate is 0.1 per cent for children less than 15 yr, 0.3 per cent for adults aged 15-39 yr and 2.1 per cent for adults aged 40 and above[5]. HAV infection in patients with pre-existing chronic liver disease is associated with high mortality[5].

The HAV virion is a non-enveloped, spherical particle with a diameter of 27-32 nm. It contains 7.5-kb single-stranded RNA genome, which displays a high degree of antigenic (amino acid) and genetic (nucleotide) conservation. Based on its nucleotide sequence analysis of 5'UTR region, it has been classified into seven different genotypes [human (I-III & VII) and simian (IV-VI) genotypes]. Genotypes I and III are each divided into sub-genotypes A and B[5],[6]. The 5'UTR region of its genome contains a complicated stem and loop structure with two pyrimidine-rich tracts, indicating the presence of a complex secondary structure, with enough genetic diversity, which is useful in identification of its genotypes and sub-genotypes. Majority of human HAV genotypes belong to the genotypes I and III; different genotypes (IA, IB and IIIA) with a predominance of genotype IIIA are known to be circulating in India[2],[3],[4],[7],[8].

The present study was planned to do molecular characterization of HAV IgM positivity in children hospitalized at a tertiary care centre at Jaipur, Rajasthan, India, to find out the genotypes prevalent in this part of the country.


   Material & Methods Top


A total of 1269 blood samples were collected from the patients between 0 and 15 yr of age, hospitalized at J.K. Lone Hospital, a paediatric hospital attached to SMS Medical College, Jaipur, having signs and symptoms suggestive of acute viral hepatitis (AVH). Duration of the study was from January 2012 to December 2014. Questionnaire specifying patient's name, age, sex, address, duration of illness, sign and symptoms of hepatitis was filled, and informed written consent was taken from parent/guardian. Peripheral blood samples (5 ml) were collected in a plain vial. Serum was separated and aliquoted in two vials; one was used for serological analysis and other was stored at −80°C until further use. Serum biochemistry [bilirubin, serum aspartate aminotranferase (AST), serum alanine aminotransferase (ALT), etc.] values were recorded from reports of investigations. Institutional Ethics Committee approval was also taken for the study. Sample collection, serological testing and molecular characterization were carried out at the Virology Laboratory, Advanced Basic Sciences and Clinical Research Laboratory, SMS Medical College, Jaipur.

The minimum sample size required for the study was calculated as 625 (based on the prevalence rate of 6.7%, at 95% confidence interval, 2% absolute error and 0.8 power) employing the previously described formula[9]. As only 1269 samples were included, power of the study was 0.9 at 99 per cent confidence interval.

Inclusion & exclusion criteria: All paediatric patients hospitalized with signs and symptoms of AVH (0-15 yr age group) from January 2012 to December 2014 were included in the study. Outdoor patients and patients not having signs or symptoms of hepatitis were excluded from the study.

Enzyme-linked immunosorbent assay (ELISA): ELISA was performed for detection of anti-HAV IgM antibody using commercial kit (DiaSorin, Italy) as per the manufacturer's instructions. The reading was taken at 450 nm on Infinite N200 Pro NanoQuant Spectrophotometer (Tecan, Switzerland). Samples were also tested for hepatitis B surface antigen, hepatitis C virus total antibody and hepatitis E virus IgM antibody at Virus Diagnostic Research Laboratory (ICMR-VDRL).

Nucleic acid extraction and nested polymerase chain reaction (PCR): Viral RNA was extracted from (171 ELISA-positive samples with less than seven days history of illness) frozen aliquots of serum sample with easyMAG extractor (bioMerieux, France) and RNA quantity was checked using Infinite N200 Pro NanoQuant Spectrophotometer (Tecan, Switzerland) by calculating the ratio of absorbance at 260 and 280 nm. Sample containing an amount of 1-2 μg total RNA was used for complementary DNA (cDNA) synthesis by High Capacity cDNA synthesis kit (Applied Biosystems, USA). Nested PCR was done to determine virus genotype, using two sets of primers [5'NCR (outer) forward primer (GGCTACGGGTGAAACCTCTT) and 5'NCR (outer) reverse primer (CCAATTTTGCAACTTCATG)] and [5'NCR (inner) forward primer (TAACAGCGGCGGATATTGGTG) and 5'NCR (inner) reverse primer (GGTCAAGGCCACTCCCAAC)][2]. The amplicons were analyzed on 2 per cent agarose/Tris-borate-EDTA (TBE) gel stained with ethidium bromide and visualized on gel documentation system (Bio-Rad, USA) and inner amplified products were excised from gel for further purification.

Sequencing: Representative PCR-positive products (44) were processed for sequencing. Briefly; inner amplified PCR products were purified using PureLink Quick Gel Extraction and PCR Purification Combo Kit (Invitrogen, USA). These were further checked on 2 per cent agarose/Tris borate EDTA (TBE) gel for the purity and integrity of the band. Both the forward and reverse strands of the amplicons were sequenced using BigDye Terminator Cycle Sequencing Ready Reaction Kit version 3.0 (Applied Biosystems, USA) on 3500 DX Genetic analyzer (ABI, USA).

Phylogenetic analysis: The sequences generated from the sequencer were confirmed by BLAST analysis (www.ncbi.nlm.nih.gov/blast) and aligned by NJ algorithm at 1000 bootstrap replications using MEGA6.0[10] (Mega Software Solution Inc., USA). The phylogenetic tree generated was viewed using Tree View.

Statistical analysis: Comparison between data sets was performed using one-way analysis of variance followed by Student's t test and Chi-square test. All statistical analyses were performed using GraphPad Prism 5.0 (Graph Pad Software Inc., San Diego, CA, USA).


   Results Top


Of the 1269 patients enrolled in the study, 839 (66.11%) were males and 430 (33.88%) were females and 42.31 per cent patients (n=537) were less than five years of age. A total of 642 (50.6%) patients were positive for anti-HAV IgM. Total serum bilirubin level was found to be <5 mg/dl in 779 patients (61.38%), 6-10 mg/dl in 283 patients (22.30%) and >11 mg/dl in 207 patients (16.31%). The levels of AST and ALT were found to be raised with mean AST level of 1315.76±1085.42 in HAV-positive samples versus 1015.42±921.23 in HAV-negative samples. Mean ALT in HAV-positive samples was 1349.67±1039.18 versus 979.63±791.67 in HAV-negative samples.

Difference in age-wise positivity (P=0.014) was significant [Table 1]. Of the 642 (50.59%) samples found positive for anti-HAV IgM antibody, 435 (34.27%) were from male patients and 207 (16.33%) female patients. Among them, number of children belonging to age group 0-10 yr were higher (n=567, 55.64%) than other age groups (n=75, 29.88%). Peak positivity of HAV (50 to 86.6%) was seen during June to September, and least positivity (25 to 38%) was seen during December to February [Figure 1]. Of the 171 samples tested by PCR, 141 (82.45%) were found to be positive. On sequencing of representative 44 HAV PCR-positive samples, all were found to be of genotype IIIA (Gene bank Accession number: KT891942-KT891985) as shown in phylogenetic tree [Figure 2]. All the samples showed similarity with other Indian samples from Chandigarh (JX481901-JX481910; JX390729-JX390733)[11], Shimla (FJ227129-FJ227134)[3], Kottayam (DQ004690-DQ004693)[2] and samples from Norway (AJ299464)[12] and Japan (AB279734)[13].
Table 1: Age-wise distribution of hepatitis A virus. (HAV) ELISA-positive cases

Click here to view
Figure 1: Seasonal trends of hepatitis A virus (HAV) from January 2012 to December 2014.

Click here to view
Figure 2: Phylogenetic analysis of 44 PCR positive representative hepatitis A virus samples based on 5’ UTR region.

Click here to view


Substitutions between nucleotides 500 and 700 of the 5'UTR region were observed in seven samples. Substitution of G to A at nucleotide 578 was detected in three samples (KT891967, KT891975 and KT891977) and A to G at nucleotide 629 in one sample (KT891949). Substitution of A to T at nucleotide 598 was detected in one sample (KT891971), while C to T substitution at nucleotide 605 was detected in two samples (KT891970, KT891983) when compared with wild-type HAV GBM/WT RNA (X75215).


   Discussion Top


AVH due to HAV occurs worldwide and is endemic in Asia, Africa, Latin America and the Middle East[14]. In India, it remains a major public health problem despite improving sanitation, health awareness and socio-economic conditions. The present study was done on children with AVH; 50.59 per cent samples were found positive for anti-HAV IgM antibody. A wide variation in positivity (27.2-74.5%) has been reported from hospitalized patients in India: from Lucknow (27.2%)[15], Madras (now Chennai) (38.6%)[16] and Hyderabad (74.5%)[17]. Even wider variation in positivity has been reported among non-hospitalized paediatric patients from 10.3 to 92.85 per cent from various parts of India[3],[4],[7],[18].

In the present study, higher HAV IgM positivity of 56.64 per cent was observed in children of age group 6-10 yr; similar finding has been reported from Delhi (59.5%)[19]. However, other authors have grouped together 0-10 yr age and reported 80.95 per cent positivity from Shimla[3] and 60 per cent from Chennai[16].

Genotyping of samples provides insight into type of transmission whether the infection is due to indigenous strain or imported strain. In our study on phylogenetic analysis, all the samples tested belonged to genotype IIIA. Studies from various parts of India, such as, Jabalpur[7], Himachal Pradesh[3], Maharashtra[20], Tamil Nadu[4], Chandigarh[11], also reported genotype IIIA as the only genotype found, circulating in the various parts of India. Circulation of other genotypes have also been reported from different parts of India. Genotype IA was reported in 21 per cent patients from Guwahati along with genotype IIIA in 79 per cent patients[21]. In a study from Delhi also, genotype III was reported as the predominant genotype (70%) followed by genotype IA (30%)[8]. Moreover, co-circulation of genotypes IIIA (74.2%) and IB (9.7%) and co-infection (16.1%) with both IIIA and IB genotypes have been reported from Pune[22].

Similar to our study, genotype IIIA have been reported to be prevalent in the United States, Central Asian countries, Denmark, Korea, etc[6],[23],[24]. Both genotype IA and IIIA have also been found prevalent in Korea[23],[24] and Spain[25]. In China, both genotype IA and IB were found to be prevalent[26]. Genotype IA was prevalent in Mexico, Canada and Argentina, while both genotype IA and IB are known to be prevalent in Jordan, Iraq, Japan, Egypt, Turkey, Brazil, Italy, North Africa, South Africa, Norway, Greece, Thailand and Tunisia[27],[28],[29],[30], whereas genotype II has been reported from Netherland, France and Sierra Leone[6].

On analyzing genetic diversity by 5'UTR region sequencing, 98-100 per cent nucleotide identity was observed in our samples taking wild type HAV GBM/WT RNA (X75215) as control. Our results were in concordance with various other studies reported from India which showed approximately 98-99.9 per cent nucleotide identity[11],[31]. However, base substitution was observed in seven samples between nucleotides 500 and 700 of the 5'UTR region. Singh et al[11] also reported base substitution at 200-500 region of 5'NTR while comparing their strains with wild type HAV GBM/WT RNA (X75215). They observed G to A substitution at nucleotide 324 position in all their samples (which is responsible for stable structure of its genome but has no correlation with disease severity) as was also reported by Fujiwara et al[30]. Other substitutions such as A161G (33.3%), C207T (53.3%), A559G (20%), C105T (100%), T148C (40%), C187T (100%), G213A (100%), G266A (100%), domain IV substitution (G490A, T517C) and insertion at 431 position have also been reported by Singh et al[11]; however, no correlation to disease severity has been reported in these substitutions. No correlation could be ascertained between biochemical and clinical profiles of patients with genotypes as only one genotype was detected in our studied patients. However, Yoon et al[24] from Korea reported that genotype IIIA was more virulent than genotype IA, while Fujiwara et al[30] from Japan reported no apparent associations between disease severity and sequences of the genotype-determining region.

Our study had some limitations. One major limitation was that all our samples were from hospitalized patients, with more severe disease, and higher than normal ALT and AST levels. It is important to study non-hospitalized patients as well as also samples from outbreak cases. Another limitation of our study was that the patients were not followed up, so the information about the clinical course of the disease was not available.

In conclusion, HAV was found to be positive in about 50 per cent of patients, predominantly from June to September. HAV IgM positivity was detected mostly in children below 10 yr of age. Only genotype IIIA was found in our patients and as a result, no correlation with disease severity could be ascertained.

Financial support & sponsorship: Authors acknowledge the financial support from the Indian Council of Medical Research, New Delhi, to the first author (BM) for establishment of ICMR Grade-I Virology Laboratory and Senior Research Fellowship to the second author (AK).

Conflicts of Interest: None.



 
   References Top

1.
World Health Organization. WHO/CDS/CSR/EDC/2014. Hepatitis A. Department of Communicable Disease Surveillance and Response. Available at: http://www.who.int7csr/disease/hepatitis/HepatitisA-whocdscsredc2014-pdf, accessed on April 30, 2018.   Back to cited text no. 1
    
2.
Arankalle VA, Sarada Devi KL, Lole KS, Shenoy KT, Verma V, Haneephabi M. Molecular characterization of hepatitis A virus from a large outbreak from Kerala, India. Indian J Med Res 2006; 123 : 760-9.  Back to cited text no. 2
    
3.
Chobe LP, Arankalle VA. Investigation of a hepatitis A outbreak from Shimla Himachal Pradesh. Indian J Med Res 2009; 130 : 179-84.  Back to cited text no. 3
    
4.
Raju S, Rajendran P, Gunasekaran P, Skeriff AK, Mukesh Kumar DJ, Ashok G. Molecular characterization of hepatitis a virus from sporadic and epidemic cases of jaundice in Tamil Nadu, India. Pak J Biotechnol 2011; 8 : 45-53.  Back to cited text no. 4
    
5.
Hollinger FB, Ticehurst JR. Hepatitis A virus. In: Knipe DM, Howley PM, editors. Fields virology, Vol. 1. Philadelphia: Lippincott Williams & Wilkins; 1996. p.735-82.  Back to cited text no. 5
    
6.
Nainan OV, Xia G, Vaughan G, Margolis HS. Diagnosis of hepatitis A virus infection: a molecular approach. Clin Microbiol Rev 2006; 19 : 63-79.  Back to cited text no. 6
    
7.
Barde PV, Shukla MK, Pathak R, Kori BK, Bharti PK. Circulation of hepatitis A genotype IIIA virus in paediatric patients in central India. Indian J Med Res 2014; 139 : 940-4.  Back to cited text no. 7
    
8.
Hussain Z, Husain SA, Almajhdi FN, Kar P. Immunological and molecular epidemiological characteristics of acute and fulminant viral hepatitis A. Virol J 2011; 8 : 254.  Back to cited text no. 8
    
9.
Daniel WW. Biostatistics: A foundation for analysis in the health sciences, 7th ed. New York: John Wiley & Sons; 1999.  Back to cited text no. 9
    
10.
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 2013; 30 : 2725-9.  Back to cited text no. 10
    
11.
Singh MP, Majumdar M, Thapa BR, Gupta PK, Khurana J, Budhathoki B, et al. Molecular characterization of hepatitis A virus strains in a tertiary care health set up in North western India. Indian J Med Res 2015; 141 : 213-20.  Back to cited text no. 11
    
12.
Stene-JK, Skaug K, Blystad H. Surveillance of hepatitis A by molecular epidemiologic studies. Tidsskr Nor Laegeforen 1999; 119 : 3725-9.  Back to cited text no. 12
    
13.
Endo K, Takahashi M, Masuko K, Inoue K, Akahane Y, Okamoto H. Full-length sequences of subgenotype IIIA and IIIB hepatitis A virus isolates: characterization of genotype III HAV genomes. Virus Res 2007; 126 : 116-27.  Back to cited text no. 13
    
14.
Franco E, Meleleo C, Serino L, Sorbara D, Zaratti L. Hepatitis A: Epidemiology and prevention in developing countries. World J Hepatol 2012; 4 : 68-73.   Back to cited text no. 14
    
15.
Jain P, Prakash S, Gupta S, Singh KP, Shrivastava S, Singh DD, et al. Prevalence of hepatitis A virus, hepatitis B virus, hepatitis C virus, hepatitis D virus and hepatitis E virus as causes of acute viral hepatitis in North India: A hospital based study. Indian J Med Microbiol 2013; 31 : 261-5.  Back to cited text no. 15
    
16.
Malathi S, Mohanavalli B, Menon T, Srilatha P, Sankaranarayanan VS, Raju BB, et al. Clinical and viral marker pattern of acute sporadic hepatitis in children in Madras, South India. J Trop Pediatr 1998; 44 : 275-8.  Back to cited text no. 16
    
17.
Syed R, Mohammed AH, Sindiri PK, Nathani AA, Rao VVR, Satti VP. Sero-epidemiology of hepatitis A virus in Hyderabad, South India. J Med Allied Sci 2012; 2 : 58-61.  Back to cited text no. 17
    
18.
Joshi MS, Bhalla S, Kalrao VR, Dhongade RK, Chitambar SD. Exploring the concurrent presence of hepatitis A virus genome in serum, stool, saliva, and urine samples of hepatitis A patients. Diagn Microbiol Infect Dis 2014; 78 : 379-82.  Back to cited text no. 18
    
19.
Kotwal A, Singh H, Verma AK, Gupta RM, Jain S, Sinha S, et al. A study of Hepatitis A and E virus seropositivity profile amongst young healthy adults in India. Med J Armed Forces India 2014; 70 : 225-9.  Back to cited text no. 19
    
20.
Chadha MS, Lole KS, Bora MH, Arankalle VA. Outbreaks of hepatitis A among children in Western India. Trans R Soc Trop Med Hyg 2009; 103 : 911-6.  Back to cited text no. 20
    
21.
Bose M, Bose S, Saikia A, Medhi S, Deka M. Molecular epidemiology of hepatitis A virus infection in Northeast India. J Med Virol 2015; 87 : 1218-24.  Back to cited text no. 21
    
22.
Chitambar S, Joshi M, Lole K, Walimbe A, Vaidya S. Cocirculation of and coinfections with hepatitis A virus subgenotypes IIIA and IB in patients from Pune, Western India. Hepatol Res 2007; 37: 85-93.  Back to cited text no. 22
    
23.
Lee KO, Jeong SJ, Seong HS, Kim KT, Hwang YS, Kim GY, et al. Genetic analysis of hepatitis A virus isolated from Korea. J Bacteriol Virol 2009; 39 : 165-71.  Back to cited text no. 23
    
24.
Yoon YK, Yeon JE, Kim JH, Sim HS, Kim JY, Park DW, et al. Comparative analysis of disease severity between genotypes IA and IIIA of hepatitis A virus. J Med Virol 2011; 83 : 1308-14.  Back to cited text no. 24
    
25.
Pina S, Buti M, Jardí R, Clemente-Casares P, Jofre J, Girones R. Genetic analysis of hepatitis A virus strains recovered from the environment and from patients with acute hepatitis. J Gen Virol 2001; 82 (Pt 12) : 2955-63.  Back to cited text no. 25
    
26.
Cao J, Wang Y, Song H, Meng Q, Sheng L, Bian T, et al. Hepatitis A outbreaks in China during 2006: Application of molecular epidemiology. Hepatol Int 2009; 3 : 356-63.  Back to cited text no. 26
    
27.
Barameechai K, Sa-Nguanmoo P, Suwannakarn K, Thongmee C, Payungporn S, Chongsrisawat V, et al. Molecular characterisation of the hepatitis A virus circulating in the 2001-2005 outbreaks in Thailand. Ann Trop Med Parasitol 2008; 102 : 247-57.  Back to cited text no. 27
    
28.
Poovorawan K, Chattakul P, Chattakul S, Thongmee T, Theamboonlers A, Komolmit P, et al. The important role of early diagnosis and preventive management during a large-scale outbreak of hepatitis A in Thailand. Pathog Glob Health 2013; 107 : 367-72.  Back to cited text no. 28
    
29.
Kokkinos P, Ziros P, Filippidou S, Mpampounakis I, Vantarakis A. Molecular characterization of hepatitis A virus isolates from environmental and clinical samples in Greece. Virol J 2010; 7 : 235.  Back to cited text no. 29
    
30.
Fujiwara K, Yokosuka O, Imazeki F, Saisho H, Saotome N, Suzuki K, et al. Analysis of the genotype-determining region of hepatitis A viral RNA in relation to disease severities. Hepatol Res 2003; 25 : 124-34.  Back to cited text no. 30
    
31.
Kulkarni MA, Walimbe AM, Cherian S, Arankalle VA. Full length genomes of genotype IIIA hepatitis A virus strains (1995-2008) from India and estimates of the evolutionary rates and ages. Infect Genet Evol 2009; 9 : 1287-94.  Back to cited text no. 31
    


    Figures

  [Figure 1], [Figure 2]
 
 
    Tables

  [Table 1]



 

Top
 
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
    Abstract
    Material & M...
   Results
   Discussion
    References
    Article Figures
    Article Tables

 Article Access Statistics
    Viewed638    
    Printed2    
    Emailed0    
    PDF Downloaded192    
    Comments [Add]    

Recommend this journal