Indan Journal of Medical Research Indan Journal of Medical Research Indan Journal of Medical Research Indan Journal of Medical Research
  Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login  
  Home Print this page Email this page Small font sizeDefault font sizeIncrease font size Users Online: 2074       

   Table of Contents      
ORIGINAL ARTICLE
Year : 2017  |  Volume : 146  |  Issue : 1  |  Page : 105-110

New Delhi metallo-β-lactamase - type carbapenemases producing Escherichia coli isolates from hospitalized patients: A pilot study


1 Division of Microbiology, National Centre for Disease Control, New Delhi, India
2 Department of Pathology, Himalayan Institute of Medical Sciences, Swami Rama Himalayan University, Dehradun, India
3 Department of Biochemistry, Santosh Medical College, Ghaziabad, India
4 Department of Microbiology, Postgraduate Institute of Medical Education and Research & Dr. Ram Manohar Lohia Hospital, New Delhi, India

Date of Submission20-Apr-2015
Date of Web Publication22-Nov-2017

Correspondence Address:
Shashi Khare
Division of Microbiology, National Centre for Diseases Control, 22-Sham Nath Marg, New 110 054
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ijmr.IJMR_594_15

Rights and Permissions
   Abstract 


Background & objectives: Resistances to carbapenem group of antimicrobials among Escherichia coli due to production of carbapenemases, especially the New Delhi metallo-β-lactamase (NDM) types, pose serious challenges in the treatment of infections in healthcare settings. This study was undertaken to detect NDM producing E. coli isolates from hospitalized patients with urinary tract infection (UTI).
Methods: A total of 30 non-repetitive isolates of E. coli from hospitalized patients with clinical suspicion of UTI were subjected to antimicrobial susceptibility testing. Screening for the production of extended-spectrum β-lactamases (ESBL) was carried out by minimum inhibitory concentration (MIC) test strip ESBL followed by phenotypic confirmation by double-disc synergy test. Phenotypic confirmation of carbapenemase production was carried out by MIC test strip metallo-β-lactamases. Molecular identification of the blaNDM gene was carried out by polymerase chain reaction (PCR) and sequencing of the amplified fragment.
Results: Seventeen of the 30 isolates were detected as ESBL producers, of which three were found to be carbapenemase producers. NDM genes were detected by PCR followed by gene sequencing in all three isolates positive for ESBL as well as carbapenemase. The amino acid sequence of the three isolates showed complete identity to the reference sequences of NDM-1, NDM-4 and NDM-8, respectively.
Interpretation & conclusions: Our study showed the circulation of NDM variants among the clinical isolates of E. coli that were producers of ESBL as well as carbapenemase.

Keywords: Extended-spectrum beta-lactamases - metallo-β-lactamase - New Delhi metallo-β-lactamase type 1 - New Delhi metallo-β-lactamase variants


How to cite this article:
Grover SS, Doda A, Gupta N, Gandhoke I, Batra J, Hans C, Khare S. New Delhi metallo-β-lactamase - type carbapenemases producing Escherichia coli isolates from hospitalized patients: A pilot study. Indian J Med Res 2017;146:105-10

How to cite this URL:
Grover SS, Doda A, Gupta N, Gandhoke I, Batra J, Hans C, Khare S. New Delhi metallo-β-lactamase - type carbapenemases producing Escherichia coli isolates from hospitalized patients: A pilot study. Indian J Med Res [serial online] 2017 [cited 2019 Dec 12];146:105-10. Available from: http://www.ijmr.org.in/text.asp?2017/146/1/105/219016



Multiple drug resistance among  Escherichia More Details coli, a common pathogen associated with urinary tract infection (UTI) in hospitalized patients[1], is regarded as a major problem encountered by clinicians. This is mainly contributed by extended-spectrum β-lactamases (ESBLs) type of resistance among E. coli resulting in resistance to a myriad of antibiotics including third-generation cephalosporin. Carbapenems are powerful group of antimicrobials that are not inactivated by ESBLs and, therefore, are regarded as the treatment of choice for infections by ESBL producers[2]. However, recent reports of resistance to carbapenem due to carbapenemase production have posed serious challenges in the treatment of such infections[3]. The New Delhi metallo-β-lactamase (NDM) and closely related enzymes, which are zinc-requiring metallo-β-lactamases (MBLs), capable of hydrolyzing all penicillins, cephalosporins and carbapenem group of antimicrobials, are among the most recently identified carbapenemases. The gene that encodes NDM is called blaNDM gene and has been identified on bacterial chromosomes and plasmids[3]. The present study was carried out to detect and analyze NDM producing isolates of E. coli obtained from hospitalized patients suffering from UTI in a tertiary care hospital in north India.


   Material & Methods Top


The study included a total of 30 non-repetitive isolates of E. coli from 66 urine samples randomly selected from the daily urine samples referred from clinically suspected cases of UTI admitted in the Intensive Care Unit of Ram Manohar Lohia Hospital, a tertiary care hospital in New Delhi, India, between May and July 2012. Identification of E. coli isolates was based on culture and biochemical characteristics[4].

The samples were transported to the Division of Microbiology, National Centre for Diseases Control (NCDC), New Delhi. The study was approved by the NCDC ethics committee.

Antimicrobial susceptibility testing and determination of minimum inhibitory concentration (MIC) for carbapenems: Antimicrobial susceptibility testing was carried out by the Kirby-Bauer method[5] and the results were interpreted as per the Clinical Laboratory Standards Institute (CLSI) guidelines[6]. The antimicrobial discs were commercially procured (Becton Dickinson, USA). The antimicrobial discs used were meropenem (MEM-10 μg) and imipenem (IPM-10 μg). In addition, ampicillin (10 μg), co-trimoxazole (25 μg), amikacin (30 μg), gentamicin (10 μg), nitrofurantoin (300 μg), norfloxacin (10 μg), cefoxitin (30 μg), cefotaxime (30 μg), ceftazidime (30 μg), cefepime (30 μg) and amoxicillin-clavulanic acid (20/10 μg) discs were also employed. The zone of inhibition was measured and interpreted as per the CLSI guidelines.

Minimum inhibitory concentration (MIC) for carbapenems was determined by commercial MIC test strip containing gradient of antimicrobial concentrations of meropenem and imipenem from 0.002 to 32μg/ml (Liofilchem, Italy; www.liofilchem.net). MIC was determined based on CLSI breakpoint for meropenem and imipenem considering MIC (μg/ml) ≥1 as susceptible, >1 to <4 as intermediate and ≥4 as resistant[6].

Screening for ESBL producers: The screening of all the E. coli isolates for ESBL production was carried on the basis of resistance to cephalosporin by Kirby-Bauer method[5]. These isolates were further screened by MIC test strip ESBL (Liofilchem, Italy) followed by phenotypic confirmation by double-disc synergy test (DDST)[7]. DDST was carried out by placing four discs, viz., cefoxitin (30 μg), cefotaxime (30 μg), ceftazidime (30 μg) and cefepime (30 μg), radially at a distance of 20 mm each from a disc containing amoxicillin-clavulanic acid (20/10 μg) on a lawn culture of the E. coli isolate on Mueller-Hinton Agar (MHA) plate. The plates were incubated aerobically at 37°C. The isolates were confirmed as ESBL producer, if the zone size around any of the discs was enhanced towards amoxicillin-clavulanic acid disc[7],[8],[9]. K. pneumoniae ATCC 700603 (ESBL producer) strain was used as positive control.

Screening for metallo-β-lactamase (MBL) type carbapenemase production: This was carried out using commercial MIC test strip MBL (Liofilchem), one of the methods commonly employed for presumptive screening of MBL producing strains[10]. The range of antimicrobials in MBL strip had imipenem (IMI) gradient at one end (4-256 μg/ml) and gradient of imipenem (1-64 μg/ml) plus a constant level of EDTA (4 μg/ml) at other end (IMD). The isolate was considered as MBL producer if MIC ratio of (IMI/IMD) was ≥8[10].

Detection of New Delhi metallo-β-lactamase (NDM) gene: The isolates showing evidence of NDM production in MIC test strip MBL were further subjected to detection of blaNDM gene by PCR using the pre published sequences, forward 5'- ACCGCCTGGACCGATGACCA-3’ and reverse 5'- GCCAAAGTTGGGCGCGGTTG -3’ which amplified 264 bp fragment of the blaNDM gene[11]. PCR products of all the positive isolates were subjected to sequencing. The amplicons from the positive isolates were purified by PCR purification kit (QIAGEN, Hidden, Germany) and sequenced on ABI PRISM 3130XL sequencer (Applied Biosystems, USA) using Big Dye Terminator cycle sequencing kit (Perkin Elmer). In the sequences so obtained, the accuracy of the base calling with the chromatogram peaks was checked using BIOEDIT software (http://www.mbio.ncsu.edu/bioedit/bioedit.html) and edited wherever necessary, followed by blast at the National Center for Biotechnology Information website (http://www.ncbi.nlm.nih.gov/blast). The derived sequences were aligned with reference sequences from the database of GenBank. The derived sequences were submitted to the GenBank and accession numbers were obtained.


   Results Top


A total of 30 E. coli isolates from 30 UTI patients in Delhi were screened for drug resistance. The age group of these UTI patients ranged from 21 to 70 yr (mean 41±11 yr) with male:female ratio as 1:2.

Overall resistance pattern of E. coli isolates against various antimicrobials were as follows: ampicillin (100%), co-trimoxazole (73.3%), gentamicin (53.3%), amikacin (46.7%), nitrofurantoin (43.3%), norfloxacin (33.3%) amoxicillin-clavulanic acid (43.3%), cefoxitin (56.7%), cefotaxime (46.7%), ceftazidime (56.7%), cefepime (56.7%), imipenem (10%) and meropenem (10%).

Resistance pattern for carbapenems: Analysis of isolates of E. coli by disc diffusion and MIC test strip determination revealed three of the 30 isolates as resistant to both meropenem and imipenem and additionally three as intermediate to both the antimicrobials.

Screening for ESBL production by MIC test strip ESBL: Of the 30 isolates of E. coli, 17 were phenotypically ESBL producers by MIC test strip method while three were found to be resistant to meropenem and imipenem. However, three more isolates were in the category of intermediate resistant to these two antimicrobials.

Phenotypic confirmation of ESBL production: All the 17 (56.7%) E. coli isolates screened positive for ESBL by disc diffusion and MIC test strip were confirmed to be ESBL producers by DDST. These 17 isolates were resistant to cefepime, thus ruling out AmpC production. AmpC production in the remaining 13 (43.3%) isolates could not be ruled out.

Screening for production of MBL type carbapenemase: Of the six isolates that were either intermediately resistant or resistant to carbapenems (both meropenem and imipenem) by disc diffusion and MIC test strip, only three were further identified as MBL producers by MIC test strip MBL and the other three intermediate resistant isolates did not show any MBL production [Table 1].
Table 1: Production of extended spectrum beta-lactamases (ESBL) and New Delhi Metallo-beta-lactamase-1 (NDM-1) among isolates of Escherichia coli (n=6) showing resistance or intermediate resistance to carbapenems (meropenem and imipenem)

Click here to view


Identification of blaNDM gene: Of the six isolates that were intermediate or resistant to both meropenem and imipenem on the basis of disc diffusion and MIC test strip as well as by MIC test strip MBL, blaNDM gene was detected in the three resistant isolates only that were confirmed as NDM producers by PCR method [Table 1]. This reconfirmed that intermediate isolates were not MBL producers.

Molecular categorization of blaNDM gene: The partial nucleotide sequence of first isolate (NSU_1, Accession number JX292120.1) showed complete identity with the sequence of reference strain NDM-1. Among the remaining two isolates, one (NSU_2, Accession number JX292121.1) showed an amino acid substitution at 154 (Met →Leu) with 100 per cent identity to the NDM-4 reference sequence and the other (NSU_3, Accession number KJ410407) showed mutations at amino acid 130 (Asp→Gly) and at 154 (Met→Leu), identical to the reference sequence of NDM-8 [Figure 1].
Figure 1: Molecular categorization of blaNDM gene: The Plot dot identities of the derived sequence from the study (NSU-1, 2 and 3) and published New Delhi metallo-ß-lactamase-4 (NDM-4) (Accession number: WP032492624) sequence, NDM-8 (Accession number: JQ 348841) sequence from the database against NDM-1 (Accession number: AHY37787).

Click here to view



   Discussion Top


In the present study, ESBL production was seen in 17 of the 30 E. coli isolates. Multiple surveys have shown the rate of ESBL production among E. coli to be highest in India (80%), followed by China (60%), while rates are lower elsewhere in East and Southeast Asia (<30%) and other countries such as Europe, Australia and North America (range 5-10%)[12],[13],[14]. There has been a steady rise in the prevalence of ESBL producing E. coli in India, the reported prevalence increased from 18 to 40 per cent during 2003 to 2008 while it rose to 40-75 per cent during 2009 to 2012[2],[12],[13],[14].

Reports prior to 2006 indicated that most E. coli isolates were sensitive to carbapenems. Studies carried out by Akram et al[15] (2002 to 2006) and Padmini and Appalaraju[16] (2002 to 2003) in northern India reported 100 per cent susceptibility to imipenem for urinary isolates of E. coli, while Menon et al[17] in their study from southern India in 2003 reported similar pattern of susceptibility for imipenem. However, subsequent reports indicated emergence of carbapenem resistance among E. coli[18]. In the present study, three of 30 (10%) E. coli isolates were resistant to both meropenem and imipenem. This was in accordance to studies from elsewhere in India viz., Delhi, Guwahati and Mumbai reporting resistance from 5.1 to 14 per cent for both these antimicrobials[19],[20],[21].

In another study from southern India, of the 4976 samples tested, 74 (1.48%) yielded multidrug resistant isolates that included 10 E. coli isolates resistant to both meropenem and imipenem[22]. In a study from Kashmir, of the 1625 Gram-negative isolates, 6.0 per cent were resistant to both meropenem and imipenem[23]. In a hospital based study on neonatal septicemia cases from Kolkata, India, 105 (37%) of the 285 samples yielded isolates identified as Enterobacteriaceae, including 27 E. coli isolates with the resistance rate for imipenem as 0 per cent in 2007, 11 per cent in 2008, 50 per cent in 2009, 25 per cent in 2010 and 37.5 per cent in 2011[24].

Several studies from India reported high incidence of NDM-like enzyme production among the carbapenem-resistant E. coli isolates from hospitals. It has been shown that NDM producing Enterobacteriaceae, including E. coli, are widespread in India[25]. The patients presented with a variety of hospital and community-associated infections, with UTI being the most common clinical symptom[26]. Deshpande et al[27]reported NDM-1 in nine E. coli isolates among 24 carbapenem resistant Enterobacteriaceae in a tertiary care centre[25]. Of the 74 E. coli isolates showing resistance to carbapenems, 34 were positive for blaNDM gene by PCR[22]. In a study from North-East India on the incidence of blaNDM gene among the clinical isolates of E. coli, of the 270 E. coli isolates from various clinical samples, during 2009-2010, NDM-1 could be detected in 14 isolates (5.2%)[20].

Up till now 12 published new variants of blaNDM gene differing from each other by one or two residues have been reported from various countries[28],[29]. However, NDM-1, 4 and 8 producing isolates were found to be circulating in Delhi as shown in our study. The sequence from one isolate (NSU_1) matched with that of NDM-1. The NDM-4 is known to differ from NDM-1 by a single amino acid substitution at position 154 (Met→Leu) and the isolate (NSU_2) showed 100 per cent nucleotide identity with NDM-4 variant. This amino acid substitution is responsible for an increased hydrolytic activity of NDM-4 compared to NDM-1 towards meropenem and imipenem[30]. The amino acid sequence of isolate NSU_3 showed substitution at position 130 (Asp→Gly) and at 154 (Met→Leu) compared with NDM-1 which is identical to NDM-8 in accordance to the published reports[28],[29],[30],[31].

In a study by Rahman et al[31], 12.3 per cent (n=13) of isolates belonging to Enterobacteriaceae family at a tertiary care hospital in northern India showed resistance or reduced susceptibility to carbapenem (imipenem or meropenem). These isolates were all positive for NDM with 13 isolates as variants of NDM-1 i.e. NDM-5(2), NDM-6(8) NDM-7(3)[31].

In conclusion, the present study highlighted the continued threat by ESBL producing E. coli in the hospital setting. The detection of NDM variants, i.e., NDM-1, NDM-4 and NDM-8 by the E. coli isolates warrants further exploration on a large scale in the country to estimate the prevalence of NDM producing strains in the clinical setting and to review future treatment strategies for UTIs in hospitalized patients particularly in the Intensive Care Units. The present study also indicates the importance of regular monitoring of drug resistance in the hospital for an urgent action to be taken for antibiotics stewardship in the country.


   Acknowledgment Top


The second author (AD) received STS grant (Reference ID: 2012-01377), from the Indian Council of Medical Research, New Delhi, India.

Conflicts of Interest:

None.



 
   References Top

1.
Nicolle LE; AMMI Canada Guidelines Committee*. Complicated urinary tract infection in adults. Can J Infect Dis Med Microbiol 2005; 16 : 349-60.  Back to cited text no. 1
    
2.
Livermore DM. Current epidemiology and growing resistance of gram-negative pathogens. Korean J Intern Med 2012; 27 : 128-42.  Back to cited text no. 2
[PUBMED]    
3.
Kumarasamy KK, Toleman MA, Walsh TR, Bagaria J, Butt F, Balakrishnan R, et al. Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: A molecular, biological, and epidemiological study. Lancet Infect Dis 2010; 10 : 597-602.  Back to cited text no. 3
[PUBMED]    
4.
Pamela BC. Enterobacteriaceae: Escherichia, Klebsiella, Proteus and other genera. In: Collee JG, Fraser AG, Marmion BP, Simmons A, editors. Mackie and McCartney practical medical microbiology. 14th ed. Edinburgh: Churchill Livingstone; 1999. p. 361-7.  Back to cited text no. 4
    
5.
Bauer AW, Kirby WM, Sherris JC, Turck M. Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathol 1966; 45 : 493-6.  Back to cited text no. 5
[PUBMED]    
6.
Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Third Informational Supplement. M100-S23. Wayne, PA: CLSI; 2013.  Back to cited text no. 6
    
7.
Jacoby GA. AmpC beta-lactamases. Clin Microbiol Rev 2009; 22 : 161-82.  Back to cited text no. 7
[PUBMED]    
8.
Grover SS, Sharma M, Chattopadhya D, Kapoor H, Pasha ST, Singh G. Phenotypic and genotypic detection of ESBL mediated cephalosporin resistance in Klebsiella pneumoniae: Emergence of high resistance against cefepime, the fourth generation cephalosporin. J Infect 2006; 53 : 279-88.  Back to cited text no. 8
[PUBMED]    
9.
Thomson KS. Extended-spectrum-beta-lactamase, AmpC, and Carbapenemase issues. J Clin Microbiol 2010; 48 : 1019-25.  Back to cited text no. 9
[PUBMED]    
10.
Nordmann P, Poirel L, Carrër A, Toleman MA, Walsh TR. How to detect NDM-1 producers. J Clin Microbiol 2011; 49 : 718-21.  Back to cited text no. 10
    
11.
Manchanda V, Rai S, Gupta S, Rautela RS, Chopra R, Rawat DS, et al. Development of TaqMan real-time polymerase chain reaction for the detection of the newly emerging form of carbapenem resistance gene in clinical isolates of Escherichia coli, Klebsiella pneumoniae, and Acinetobacter baumannii. Indian J Med Microbiol 2011; 29 : 249-53.  Back to cited text no. 11
[PUBMED]    
12.
Tankhiwale SS, Jalgaonkar SV, Ahamad S, Hassani U. Evaluation of extended spectrum beta lactamase in urinary isolates. Indian J Med Res 2004; 120 : 553-6.  Back to cited text no. 12
[PUBMED]    
13.
Taneja N, Rao P, Arora J, Dogra A. Occurrence of ESBL & Amp-C beta-lactamases & susceptibility to newer antimicrobial agents in complicated UTI. Indian J Med Res 2008; 127 : 85-8.  Back to cited text no. 13
[PUBMED]    
14.
Hawser SP, Bouchillon SK, Hoban DJ, Badal RE, Hsueh PR, Paterson DL. Emergence of high levels of extended-spectrum-beta-lactamase-producing gram-negative bacilli in the Asia-Pacific region: Data from the Study for Monitoring Antimicrobial Resistance Trends (SMART) program, 2007. Antimicrob Agents Chemother 2009; 53 : 3280-4.  Back to cited text no. 14
[PUBMED]    
15.
Akram M, Shahid M, Khan AU. Etiology and antibiotic resistance patterns of community-acquired urinary tract infections in J N M C Hospital Aligarh, India. Ann Clin Microbiol Antimicrob 2007; 6 : 4.  Back to cited text no. 15
[PUBMED]    
16.
Babypadmini S, Appalaraju B. Extended spectrum -lactamases in urinary isolates of Escherichia coli and Klebsiella pneumoniae-prevalence and susceptibility pattern in a tertiary care hospital. Indian J Med Microbiol 2004; 22 : 172-4.  Back to cited text no. 16
[PUBMED]    
17.
Menon T, Bindu D, Kumar CP, Nalini S, Thirunarayan MA. Comparison of double disc and three dimensional methods to screen for ESBL producers in a tertiary care hospital. Indian J Med Microbiol 2006; 24 : 117-20.  Back to cited text no. 17
[PUBMED]    
18.
Nagaraj S, Chandran SP, Shamanna P, Macaden R. Carbapenem resistance among Escherichia coli and Klebsiella pneumoniae in a tertiary care hospital in South India. Indian J Med Microbiol 2012; 30 : 93-5.  Back to cited text no. 18
[PUBMED]    
19.
Jha DN. Ganga Ram Study Finds High Levels of Superbug NDM1. The Times of India 2011 Oct 05. Available from: https://timesofindia.indiatimes.com/city/delhi/Ganga-Ram-study-finds-high-levels-of-superbug-NDM1/articleshow/10239023.cms, accessed on April 12, 2017.  Back to cited text no. 19
    
20.
Bora A, Ahmed GU, Hazarika NK, Prasad KN, Shukla SK, Randhawa V, et al. Incidence of bla NDM-1 gene in Escherichia coli isolates at a tertiary care referral hospital in Northeast India. Indian J Med Microbiol 2013; 31 : 250-6.  Back to cited text no. 20
[PUBMED]    
21.
Sarma JB, Bhattacharya PK, Kalita D, Rajbangshi M. Multidrug-resistant Enterobacteriaceae including metallo-β-lactamase producers are predominant pathogens of healthcare-associated infections in an Indian teaching hospital. Indian J Med Microbiol 2011; 29 : 22-7.  Back to cited text no. 21
[PUBMED]    
22.
Shenoy KA, Jyothi EK, Ravikumar R. Phenotypic identification & molecular detection of bla (ndm-1) gene in multidrug resistant Gram-negative bacilli in a tertiary care centre. Indian J Med Res 2014; 139 : 625-31.  Back to cited text no. 22
[PUBMED]    
23.
Fomda BA, Khan A, Zahoor D. NDM-1 (New Delhi metallo beta lactamase-1) producing Gram-negative bacilli: Emergence & clinical implications. Indian J Med Res 2014; 140 : 672-8.  Back to cited text no. 23
[PUBMED]    
24.
Datta S, Roy S, Chatterjee S, Saha A, Sen B, Pal T, et al. A five-year experience of carbapenem resistance in Enterobacteriaceae causing neonatal septicaemia: Predominance of NDM-1. PLoS One 2014; 9 : e112101.  Back to cited text no. 24
[PUBMED]    
25.
Lascols C, Hackel M, Marshall SH, Hujer AM, Bouchillon S, Badal R, et al. Increasing prevalence and dissemination of NDM-1 metallo-β-lactamase in India: Data from the SMART study (2009). J Antimicrob Chemother 2011; 66 : 1992-7.  Back to cited text no. 25
[PUBMED]    
26.
Bhattacharya D, Thamizhmani R, Bhattacharya H, Sayi DS, Muruganandam N, Roy S, et al. Emergence of New Delhi metallo-β-lactamase 1 (NDM-1) producing and multidrug resistant uropathogens causing urinary tract infections in Andaman Islands, India. Microb Drug Resist 2013; 19 : 457-62.  Back to cited text no. 26
[PUBMED]    
27.
Deshpande P, Rodrigues C, Shetty A, Kapadia F, Hedge A, Soman R. New Delhi Metallo-beta lactamase (NDM-1) in Enterobacteriaceae: Treatment options with carbapenems compromised. J Assoc Physicians India 2010; 58 : 147-9.  Back to cited text no. 27
[PUBMED]    
28.
Dortet L, Poirel L, Nordmann P. Worldwide dissemination of the NDM-type carbapenemases in Gram-negative bacteria. Biomed Res Int 2014; 2014 : 249856.  Back to cited text no. 28
[PUBMED]    
29.
Tada T, Miyoshi-Akiyama T, Dahal RK, Sah MK, Ohara H, Kirikae T, et al. NDM-8 metallo-β-lactamase in a multidrug-resistant Escherichia coli strain isolated in Nepal. Antimicrob Agents Chemother 2013; 57 : 2394-6.  Back to cited text no. 29
[PUBMED]    
30.
Nordmann P, Boulanger AE, Poirel L. NDM-4 metallo-β-lactamase with increased carbapenemase activity from Escherichia coli. Antimicrob Agents Chemother 2012; 56 : 2184-6.  Back to cited text no. 30
[PUBMED]    
31.
Rahman M, Shukla SK, Prasad KN, Ovejero CM, Pati BK, Tripathi A, et al. Prevalence and molecular characterisation of New Delhi metallo-β-lactamases NDM-1, NDM-5, NDM-6 and NDM-7 in multidrug-resistant Enterobacteriaceae from India. Int J Antimicrob Agents 2014; 44 : 30-7.  Back to cited text no. 31
[PUBMED]    


    Figures

  [Figure 1]
 
 
    Tables

  [Table 1]


This article has been cited by
1 Carbapenem resistance in Escherichia coli and Klebsiella pneumoniae among Indian and international patients in North India
Namita Jaggi,Nirupama Chatterjee,Vyoma Singh,Santosh Kumar Giri,Priyambada Dwivedi,Rajesh Panwar,Ajendra Pratap Sharma
Acta Microbiologica et Immunologica Hungarica. 2019; 66(3): 367
[Pubmed] | [DOI]
2 Complete Genome Sequence of a Carbapenem-Resistant Escherichia coli Isolate with blaNDM-5 from a Dog in the United States
Gregory H. Tyson,Cong Li,Olgica Ceric,Renate Reimschuessel,Stephen Cole,Laura Peak,Shelley C. Rankin,Christina A. Cuomo
Microbiology Resource Announcements. 2019; 8(34)
[Pubmed] | [DOI]
3 Ciprofloxacin, amoxicillin, and aminoglycosides stimulate genetic and phenotypic changes in uropathogenic Escherichia coli strains
Wioletta Adamus-Bialek,Monika Wawszczak,Michal Arabski,Michal Majchrzak,Martyna Gulba,Dariusz Jarych,Pawel Parniewski,Stanislaw Gluszek
Virulence. 2019; 10(1): 260
[Pubmed] | [DOI]



 

Top
 
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
    Abstract
   Material & Methods
   Results
   Discussion
   Acknowledgment
    References
    Article Figures
    Article Tables

 Article Access Statistics
    Viewed981    
    Printed4    
    Emailed0    
    PDF Downloaded250    
    Comments [Add]    
    Cited by others 3    

Recommend this journal