Indan Journal of Medical Research Indan Journal of Medical Research Indan Journal of Medical Research Indan Journal of Medical Research
  Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login  
  Home Print this page Email this page Small font sizeDefault font sizeIncrease font size Users Online: 627       

   Table of Contents      
ORIGINAL ARTICLE
Year : 2016  |  Volume : 143  |  Issue : 1  |  Page : 43-48

Novel ATRX gene damaging missense mutation c.6740A>C segregates with profound to severe intellectual deficiency without alpha thalassaemia


1 Hôpital Necker - Enfants Malades. Laboratoire de génétique médicale, Paris, France
2 Department of Genetics & Fetal Medecine, Fortis Hospital, New Delhi, India
3 Erfan & Bagedo Hospital, Genetics Unit, Jeddah, Saudi Arabia
4 Aziziah Maternity & Children Hospital, Jeddah, Saudi Arabia

Date of Submission17-Feb-2014
Date of Web Publication14-Mar-2016

Correspondence Address:
Habib Bouazzi
Hôpital Necker - Enfants Malades. Laboratoire de génétique médicale, Unité INSERM U781 Tour Lavoisier - 3ème étage, 149 rue de Sèvres 75743, Paris cedex 15
France
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0971-5916.178589

Rights and Permissions
   Abstract 

Background & objectives: ATRX is a recessive X-linked intellectual deficiency (X-LID) gene causing predominately alpha-thalassaemia with a wide and clinically heterogeneous spectrum of intellectual deficiency syndromes. Although alpha-thalassaemia is commonly present, some patients do not express this sign despite the ATRX gene being altered. Most pathological mutations have been localized in two different major domains, the helicase and the plant homeo-domain (PHD)-like domain. In this study we examined a family of three males having an X-linked mental deficiency and developmental delay, and tried to establish a genetic diagnosis while discussing and comparing the phenotype of our patients to those reported in the literature.
Methods: Three related males with intellectual deficiency underwent clinical investigations. We performed a karyotype analysis, CGH-array, linkage study, and X-exome sequencing in the index case to identify the genetic origin of this disorder. The X-inactivation study was carried out in the mother and Sanger sequencing was achieved in all family members to confirm the mutation.
Results: a0 novel ATRX gene missense mutation (p.His2247Pro) was identified in a family of two uncles and their nephew manifesting intellectual deficiency and specific facial features without alpha-thalassaemia. The mutation was confirmed by Sanger sequencing. It segregated with the pathological phenotype. The mother and her two daughters were found to be heterozygous.
Interpretation & conclusions: The novel mutation c.6740A>C was identified within the ATRX gene helicase domain and confirmed by Sanger sequencing in the three affected males as well as in the mother and her two daughters. This mutation was predicted to be damaging and deleterious. The novel mutation segregated with the phenotype without alpha-thalassaemia and with non-skewed X chromosome.

Keywords: Alpha thalassaemia - ATRX - exome sequencing - intellectual deficiency - novel mutation - X inactivation


How to cite this article:
Bouazzi H, Thakur S, Trujillo C, Alwasiyah MK, Munnich A. Novel ATRX gene damaging missense mutation c.6740A>C segregates with profound to severe intellectual deficiency without alpha thalassaemia. Indian J Med Res 2016;143:43-8

How to cite this URL:
Bouazzi H, Thakur S, Trujillo C, Alwasiyah MK, Munnich A. Novel ATRX gene damaging missense mutation c.6740A>C segregates with profound to severe intellectual deficiency without alpha thalassaemia. Indian J Med Res [serial online] 2016 [cited 2019 Dec 12];143:43-8. Available from: http://www.ijmr.org.in/text.asp?2016/143/1/43/178589

Alpha-thalassaemia X-linked intellectual disability (ATRX) syndrome first described in 1990 [1] , is a rare disorder and only about 170 cases have been reported worldwide [2] . Most mutations are gathered in the two major functional domains, the helicase and PHD (plant homeo domain)-like domain [3] and are directly linked to ATRX syndrome which often occurs associated with intellectual deficiency, alpha thalassaemia, learning difficulties as well as characteristic facial appearances, hypotonia, and cryptorchidism [4],[5] . However, infrequent protein c-terminal truncation mutations are constantly associated with severe urogenital defects [6] . The clinical spectrum has been protracted to involve phenotypes without alpha thalassaemia [7] , or display a mild mental disability [8] with non-skewed X-inactivation. In this study, we examined a family with three affected males.

Here we report a novel missense mutation (c.6740A>C) identified by X exome sequencing in exon 31 within the helicase domain of the ATRX gene in a family of three affected males in two generations (two brothers and their nephew) with a typical family pedigree of X-linked inheritance pattern and a clinical phenotype marked with intellectual disability, language impairment, prognathism, hypotonia, anteverted nares, large forehead, hypertelorism, open mouth, and a behavioural disorder associated with stereotypy.


   Material & Methods Top


This study was conducted in the department of Molecular Genetics, Medical Genetics Center, Necker Hospital, Paris, France, during 2005-2012. The study was approved by the institutional ethics committee. Three males with severe intellectual deficiency were identified in two generations of the same family. The proband; patient II-4 [Figure 1] was the third sibling. He had two non-affected sisters. He had been followed in the Medical Genetics Center in Necker University Hospital of Paris since 2005. He was evaluated at the age of four years with complaints of developmental delay and dysmorphism. Pregnancy was normal. Delivery was at 38 wk of amenorrhoea. His birth weight was 3.76 kg, height 51 cm and head circumference was 34 cm. The mother reported that her son had feeding difficulties. His first smile was at the age of two months, head holding at four months, walked at three years. Till the age seven, speech was absent, and he did not achieve the normal milestones for his age. His weight was 17 kg (-2SD), height 110 cm (-2SD), head circumference was normal. Dysmorphism [Figure 2] a-c) included a large forehead, hypertelorism, small nose, depressed nasal bridge, anteverted nares, tended upper lip and everted lower, an open mouth with drooling and a prognathism. He has severe hypotonia and stereotype movements. He was friendly, not aggressive and did not recognize his parents. He needed help to eat and wash. His tendon reflexes were normal. There was no hepatosplenomegaly, no urogenital abnormalities. Electrocardiogram (ECG) was normal and there were no seizures. However, electroencephalogram (EEG) revealed wide slow curve of waking and sleeping.
Figure 1. Pedigree of the family with related affected males. Black boxes indicate intellectual deficiency due to ATRX gene mutation. The asterik means that the subject carrys the mutation (c. 6740A>C) within the ATRX gene. In generation (I), three subjects carried the mutation. In generation (II) the index case is indicated by the arrow (II 4) and both sisters (II-1 and II-2) were heterozygous II-3 is an in utero foetal death (seven months of pregnancy)

Click here to view
Figure 2. Three photographs ( a, b and c ) of patient II-4, the images show the phenotype which involves a large forehead, hypertelorism, small nose, depressed nasal bridge, anteverted nares, tended upper lip and averted lower, an open mouth with drooling and a pragmatism

Click here to view


His two maternal uncles (I-1, I-2), respectively 40 and 42 yr old) had a profound intellectual disability, speech was absent, at that age they were completely dependent upon others for personal care, they could eat alone, but needed help to wash. They were followed in an external center because of their age.

Magnetic resonance imaging (MRI) was performed for the proband (patient II-3) and no abnormalities were found. Serum lactate and ammonia were normal. Iron and magnesium in serum were also normal, however, a slight anaemia was revealed in the index case (proband) and haemoglobin level was 11.5g/100ml with 80 fl of mean corpuscular volume (MCV) indicating microcytosis. Brilliant cresyl blue staining of red blood cells performed in index case did not reveal Heinz bodies (precipitated HbH). This result was subsequently confirmed by HPLC study (Bio-Rad VII Dual Instrument 4, California, USA) and there was no specific peak of haemoglobin H [Figure 3]. Haemoglobin A2 level was 2.6 per cent, HbF was 0.5 per cent and HbA was 96.9 per cent.
Figure 3. Elution haemoglobin chromatogram of patient II-3 specimen on Bio-Rad Variant V HPLC System. Time (min) represents the retention time in minutes for each fraction to elute; % Hb represents the percentage of haemoglobin in the elution peak. The retention time for each fraction is shown with the peak. HbA2 (2.6%) was eluted at a retention time of 2.91, HbF (0.5%) at a retention time of 0.35 min. The two earliest peaks of retention time 0.16 and 0.26 min correspond to HbA1a and HbA1b, respectively

Click here to view


Genetic analysis: DNA was extracted from peripheral blood of all family members, excluding the father using the standard procedure of phenol chloroform method [9] . Purity and concentration were assessed by NanoDrop ND-1000 Spectrophotometer V3-7 (Thermo Fisher Scientific, Wilmington, USA). A high resolution karyotype and array-CGH (comparative genomic hybridization) were performed in patient II-3 which did not show any chromosomal anomaly. X-chromosome inactivation study was carried out in the mothers (I-3) according to the method of methylation-sensitive PCR and fragment-lenth analysis of androgen-receptor CAG repeat polymorphism [10] . Patient II-3 and his mother were then included in a next generation sequencing project for X-LID patients in our institute using SOLiD 5500 sequencer (Life technologies Grand Island,USA). DNA (5 µg for each patient) was enriched by micro droplet PCR procedure (Raindance technology, Billerica, Massachusetts, USA) to target 11575 exons. Sorting and calling of SNP/InDel were performed using SAMTOOL and GATK softwares (Bioinformatic Programs, USA). Novelty was assessed by filtering the variants against a set of polymorphisms that are available in public databases such as dbSNP (http://www.ncbi.nlm.nih.gov/projects/SNP/), 1000 genomes (http://browser.1000genomes.org/in-dex.html), Exome Variant Server (http://evs.gs.washington.edu/EVS/), and ExaC (http://exac.broadinstitute.org/). Only non-synonymous variants or changes affecting splice sites were analyzed. All sequence variants were prioritized by scoring phylogenetic conservation and functional impact (SIFT and Polyphen-2) and analyzed by Mutation Taster program (Charite-University Berlin, Germany, Europe). Candidate variants were selected and confirmed by Sanger sequencing [11] , using the 3500XL Genetic analyzer [12] and the Big Dye cycle sequencing Kit of Applied Biosystem technology (Thermo-Fisher scientific, USA).

To sequence exon 31 of ATRX gene, forward (GGCTGGTGTTACATGTTTTGC) and revese (GCTGAAACCAACCCATAAAGA) primers were designed by Primer3 program (Cambridge, Massachusetts, USA) an online tool to design and analyze primers for PCR, and then were procured from Eurogentec (Belgium, Europe) in Belgium. X-chromosome inactivation study was carried out in the mother [10] [Figure 1].


   Results & Discussion Top


Karyotypes of three patients (I-1, I-2 and II-4) were 46, XY. The high resolution karyotype and the CGH revealed no chromosome aberrations. Inactivation affected 60 and 40 per cent of X-chromosomes. Sequencing of X-exome from patient II-3 and his mother identified a single nucleotide substitution in exon 31 of the ATRX gene (Genbank accession number NG_008838) resulting in a substitution of an adenine (A) by a cytosine (c.6740A>C), and led to the substitution of a conserved histidine to a proline (p.His2247Pro). This mutation was not detected in any of the public databases (such as Exome Variant Server, 1000 genomes, dbSNP135) and in >200 X-exomes of index patients from other XLID familes. This mutation was confirmed by Sanger sequencing in the three affected males as well as in the mother and her two daughters. This mutation was predicted to be possibly damaging by polyphen-2 with a score of 0.906 (sensitivity: 0.82; specificity: 0.94). It was predicted to be deleterious by SIFT and could affect protein function with a score of 0.02. Predictions with MutationTaster were in favour of a disease causing variant.

There were three affected males in the two generations of the affected family. All females were healthy and heterozygous. Our linkage analysis (not shown) localized the morbid gene in a locus of the X-chromosome (Xq13.1-Xq21.1). The study of this region by Sanger sequencing did not cover the entire length of ATRX gene. Only N-terminal region was involved. The absence of clinical signs such as alpha-thalassaemia or urogenital abnormalities had deterred us from going further in ATRX gene exploration, and the C terminal region was not analysed.

Linkage study and Sanger sequencing are limited, tedious and often yield false negative results. Therefore, we performed a high throughput X exome sequencing of patient II-3 and his mother that revealed a new variant which was confirmed by Sanger sequencing. Exome sequencing based on next generation technique is a tool for Mendelian disease gene discovery, revealing rare disease-related variants [13] . This technique revealed a substitution of an adenine by a cytosine (c.6740A>C) resulting in a novel missense mutation (p.His2247Pro). This mutation was found in all affected males, the mother and her two daughters who were heterozygous and asymptomatic. The mother X-chromosome inactivation pattern was not skewed. Heterozygous young sisters have a risk to transmit the genetic disorder to their offspring.

Clinical features of patient II-3 included intellectual deficiency, language delay, prognathism, a severe hypotonia, anteverted nares, large forehead, hypertelorism and a behaviour disorder associated with stereotypy. These signs largely overlap with those reported in ATRX related pathological mutations [14] and those reported by Thakur et al[2] who reported a missense mutation c.6718C>T(p.Leu2240Phe) related to the ATRX syndrome in the same exon and seven amino acids upstream the mutation similar to this study [c.6740A>C(p.His2247Pro)].

ATRX syndrome is mainly identified by intellectual deficiency, and alpha-thalassaemia [8] . Urogenital abnormality is a common presentation, however, it is not as common as alpha, thalassaemia [15] . Usually pathological mutations in the ATRX gene are associated with a large and clinically heterogeneous spectrum of X-linked mental deficiency syndromes [16] . However, with the advent of next generation sequencing, mutations have been identified resulting in less severe phenotypes lacking one or more of ATRX syndrome phenotypic features [17] . In this present study, the diagnosis of HbH performed in patient II-3 was based on the haemoglobin H inclusion body stain (brilliant cresyl blue) and the high performance liquid chromatography. The chromatograph showed no early peak at a retention time of less than one minute. Peaks at retention time 0.16 and 0.26 min represented HbA1a and HbA1b, respectively. The fractions HbA 2 and HbF were normal.

In the literature, 90 missense/nonsense pathological mutations within the ATRX gene have been reported to date [18] . Four of them are located in exon 31 (p.Leu2240Phe, p.Ile2248Thr, p.His2254pro and p. Arg2271Gly). These are pathological and are related to ATRX syndrome. Our missense mutation (p.His2247Pro) is the fifth. It is a novel mutation which has not been reported until now. We identified it in exon 31 of ATRX gene, adjacent to the known pathological mutation (p.Ile2248Thr) described by Gibbons and colleagues [6] . They reported that the mutation was associated with intellectual deficiency as well as asplenia [6] . Moreover, Leahy and his team [19] mentioned that the missense mutation (p.Arg2271Gly) in exon 31 was linked to the ATRX syndrome. The mutation (p.Leu2240Phe) reported by Thakur et al[2] segregated with similar phenotype compared with our case [Table I]. Besides, ATRX alteration has been reported in intellectual disability, without thalassaemia [16] . Tarpey and colleagues [20] have reported a case of mental deficiency syndrome without alpha-thalassaemia caused by the mutation (His>Pro) within the exon we studied but at a different position (p.His2254Pro). They described a mentally retarded case with behaviour disorder [20] .
Table I. Comparison of ATRX gene related disorders


Click here to view


In the present study, the new mutation was on an exon which belonged to helicase domain where approximately 41 per cent of ATRX syndrome causative mutations have been described [3] and segregates with the pathological phenotype. We could suggest that the alteration of ATRX gene might have an effect on the phenotype of our patients and there could be a genotype-phenotype correlation, however, functional studies with additional cases and large number of affected families are required to confirm this finding.

The limitation of this study included the absence of ATRX protein function assessment. Proteomic study should be performed to better understand the effect of the mutation on the protein.

In conclusion, our study describes a novel missense mutation of the ATRX gene helicase domain, carried by three affected males of the two generations of the same family and segregated with intellectual deficiency, dysmorphism and behaviour disorder without alpha-thalassaemia and with non-skewed X-chromosome inactivation. The large heterogeneous clinical signs spectrum associated with ATRX mutations suggests that this gene has different modes of action in different tissues. Consequently, this novel mutation c.6740A>C may alter ATRX gene function and causes variable clinical features.


   Acknowledgment Top


Authors acknowledge the Necker high throughput sequencing platform team for the technical support in performing X-exome sequencing. This work was supported by the Imaging Foundation (Necker Hospital) and INSERM institution Unity 781.

Conflicts of Interest : None.

 
   References Top

1.
Wilkie AO, Zeitlin HC, Lindenbaum RH, Buckle VJ, Fischel-Ghodsian N, Chui DH, et al. Clinical features and molecular analysis of the alpha thalassemia/mental retardation syndromes. II. Cases without detectable abnormality of the alpha globin complex. Am J Hum Genet 1990; 46 : 1127-40.   Back to cited text no. 1
    
2.
Thakur S, Ishrie M, Saxena R, Danda S, Linda R, Viswabandya A, et al. ATR-X syndrome in two siblings with a novel mutation (c.6718C>T mutation in exon 31). Indian J Med Res 2011; 134 : 483-6.   Back to cited text no. 2
    
3.
Badens C, Lacoste C, Philip N, Martini N, Courrier S, Giuliano F, et al. Mutations in PHD-like domain of the ATRX gene correlate with severe psychomotor impairment and severe urogenital abnormalities in patients with ATRX syndrome. Clin Genet 2006; 70 : 57-62.   Back to cited text no. 3
    
4.
Latiff ZA, Omar SAS, Lau D, Wong SW. Alpha-thalassemia mental retardation syndrome: A case report of two affected siblings. J Pediatr Neurol 2013; 11 : 67-70.   Back to cited text no. 4
    
5.
Gibbons RJ, McDowell TL, O′Rourke DM, Garrick D, Higgs DR. Mutations in ATRX, encoding a SWI/SNF-like protein, cause diverse changes in the pattern of DNA methylation. Nature Genet 2000; 24 : 368-71.   Back to cited text no. 5
    
6.
Gibbons RJ, Wada T, Fisher CA, Malik N, Traeger-Synodinos J. Mutations in the chromatin-associated protein ATRX. Hum Mutat 2008; 29 : 796-802.   Back to cited text no. 6
    
7.
Villard L, Toutain A, Lossi AM, Gecz J, Houdayer C, Moraine C, et al. Splicing mutation in the ATR-X gene can lead to a dysmorphic mental retardation phenotype without alpha-thalassemia. Am J Hum Genet 1996; 58 : 499-505.   Back to cited text no. 7
    
8.
Yntema HG, Poppelaars FA, Derksen E, Oudakker AR, Roosmalen R, van Bokhoven H. Expanding phenotype of XNP mutations: Mild to moderate mental retardation. Am J Med Genet 2002; 110 : 243-7.   Back to cited text no. 8
    
9.
Kirby KS. A new method for the isolation of ribonucleic acids from mammalian tissues. Biochem J 1957; 66 : 495-504.   Back to cited text no. 9
[PUBMED]    
10.
Kubota T, Nonoyama S, Wakui K, Tonoki H, Masuno M, Imaizumi K, et al. A new assay for the analysis of X-chromosome inactivation based on methylation-specific PCR. Hum Genet 1999; 104 : 49-55.   Back to cited text no. 10
    
11.
Bouazzi H, Bouaziz S, Alwasiyah MK, Trujillo C, Munnich A. Non-syndromic X linked intellectual disability in two brothers with a novel NLGN4X gene splicing mutation (NC_018934.2: g. 1202C>A). J Case Rep Stud 2015; 3 : 6.  Back to cited text no. 11
    
12.
Bouazzi H, Lesca G, Trujillo C, Alwasiyah MK, Munnich A. Nonsyndromic X-linked intellectual deficiency in three brothers with a novel MED12 missense mutation [c.5922G>T (p.Glu1974His)]. Clin Case Rep 2015; 3 : 604-9.  Back to cited text no. 12
    
13.
Bamshad MJ, Ng SB, Bigham AW, Tabor HK, Emond MJ, Nickerson DA, et al. Exome sequencing as a tool for Mendelian disease gene discovery. Nat Rev Genet 2011; 12 : 745-55.   Back to cited text no. 13
    
14.
Abidi FE, Cardoso C, Lossi A-M, Lowry RB, Depetris D, Mattéi M-G, et al. Mutation in the 5′alternatively spliced region of the XNP/ATR-X gene causes Chudley-Lowry syndrome. Eur J Hum Genet 2005; 13 : 176-83.   Back to cited text no. 14
    
15.
Gibbons R. Alpha thalassaemia-mental retardation, X linked. Orphanet J Rare Dis 2006; 1 : 15.   Back to cited text no. 15
    
16.
Jensen LR, Chen W, Moser B, Lipkowitz B, Schroeder C, Musante L, et al. Hybridisation-based resequencing of 17 X-linked intellectual disability genes in 135 patients reveals novel mutations in ATRX, SLC6A8 and PQBP. Eur J Hum Genet 2011; 19 : 717-20.   Back to cited text no. 16
    
17.
Basehore M, Michaelson CR, Levy-lahad R, Sismani C, Bird L, Friez MJ. Alpha-thalassemia intellectual disability: variable phenotypic expression among males with a recurrent nonsense mutation - c.109C>T (p.R37X). Clin Genet 2015; 87 : 461-6.  Back to cited text no. 17
    
18.
HGMD mutation result. Available from: http://hgmdtrial.biobase-international.com/hgmd/pro/everymut.php, accessed on January 4, 2016.  Back to cited text no. 18
    
19.
Leahy R, Philip R, Gibbons RJ, f0 isher C, Suri M, Reardon W. Asplenia in ATR-X syndrome: a second report. Am J Med Genet 2005; 139 : 37-9.   Back to cited text no. 19
    
20.
Tarpey PS, Smith R, Pleasance E, Whibley A, Edkins S, Hardy C, et al. A systematic, large-scale resequencing screen of X-chromosome coding exons in mental retardation. Nat Genet 2009; 41 : 535-43.  Back to cited text no. 20
    


    Figures

  [Figure 1], [Figure 2], [Figure 3]
 
 
    Tables

  [Table I]



 

Top
 
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
    Abstract
   Material & Methods
   Results & Discussion
   Acknowledgment
    References
    Article Figures
    Article Tables

 Article Access Statistics
    Viewed906    
    Printed11    
    Emailed0    
    PDF Downloaded251    
    Comments [Add]    

Recommend this journal