Indan Journal of Medical Research Indan Journal of Medical Research Indan Journal of Medical Research Indan Journal of Medical Research
  Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login  
  Home Print this page Email this page Small font sizeDefault font sizeIncrease font size Users Online: 2877       

   Table of Contents      
CORRESPONDENCE
Year : 2016  |  Volume : 143  |  Issue : 1  |  Page : 107-110

Drug resistance in Enterococcus species in a tertiary level hospital in Assam, India


Department of Microbiology, Assam Medical College, Dibrugarh 786 002, Assam, India

Date of Web Publication14-Mar-2016

Correspondence Address:
Reema Nath
Department of Microbiology, Assam Medical College, Dibrugarh 786 002, Assam
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0971-5916.178619

Rights and Permissions

How to cite this article:
Barman J, Nath R, Saikia L. Drug resistance in Enterococcus species in a tertiary level hospital in Assam, India . Indian J Med Res 2016;143:107-10

How to cite this URL:
Barman J, Nath R, Saikia L. Drug resistance in Enterococcus species in a tertiary level hospital in Assam, India . Indian J Med Res [serial online] 2016 [cited 2019 Dec 10];143:107-10. Available from: http://www.ijmr.org.in/text.asp?2016/143/1/107/178619

Sir,

Non-specific use of broad-spectrum antibiotics is responsible for conversion of enterococci, the otherwise gut commensal to opportunistic nosocomial as well as community acquired pathogen. The emergence of high level resistance to aminoglycosides has made the therapeutic combination of penicillin and gentamicin ineffective [1] . Concomitant vancomycin resistance in enterococci not only leaves fewer options for infection management due to this organism but also is important due to potential risk of vancomycin resistant gene transfer from Enterococcus to Staphylococcus aureus[2] . This laboratory based cross-sectional study was conducted in a tertiary care hospital in Assam, India, from July 2012 to June 2013 to evaluate the frequency of clinical isolates of Enterococcus spp and their resistance pattern to different antibiotics. The ethical clearance for the study was obtained from institutional ethics committee.

Our study included isolates from heterogenous specimens such as urine, blood, pus, csf0 , etc. The genus Enterococcus was identified by Gram stain, catalase test, hydrolysis of bile-esculin, PYRase test, heat tolerance at 60 ° C for 30 min in water bath and salt tolerance (6.5% NaCl) [1],[3] . Speciation was done according to the conventional scheme of Facklam and Collins [3] . Isolates identified as Enterococcus were further subjected to identification by Vitek2 automated system (bioMerieux, France). Antimicrobial susceptibility to ampicillin (10 μg), penicillin (10U), vancomycin (30 μg), teicoplanin (30 μg), linezolid (30 μg) and ciprofloxacin (5 μg) was tested for all the isolates by modified Kirby-Bauer disk diffusion method[4] as per Clinical and Laboratory Standards Institute (CLSI) guidelines [5] . Nitrofurantoin (300 μg) was tested only for urinary isolates and erythromycin (30 μg) for isolates from specimens other than urine. High level aminoglycoside resistance to gentamicin (120 μg) and streptomycin (300 μg) was also determined[5] . Minimum inhibitory concentration (MIC) of vancomycin was determined by Etest® (bioMιrieux, France). Enterococcus faecalis ATCC 29212 was used as control. Antimicrobial susceptibility was checked by Vitek2 automated system® for comparison. To detect the genotype of the vancomycin resistance gene, DNA was extracted from the culture using QIAamp DNA Purification Kit, (Qiagen; Hilden, Germany), and its quality was assessed on 1.2 per cent agarose gel, a single band of high molecular weight DNA was observed. Reference strain used was E. gallinarum ATCC 49573. Fragment of the van gene was amplified by PCR from the above isolated DNA using already published primers and PCR protocol for detection of van C-1 gene [6] . The primer used was 5'-3' (+) GAAAGACAACAGGAAGACCGC and (--) ATCGCATCACAAGCACCAATC. PCR amplicon band of 800 bp was observed. DNA sequencing was done in Xcelris Laboratory, Ahmedabad, to confirm the genotype of van C gene. Forward and reverse DNA sequencing reactions of the PCR amplicon were carried out with VAN F and VAN R primers using BDT V3.1 cycle sequencing kit on ABI 3730xl Genetic analyzer (Waltham, Massachusetts, USA). Consensus sequence of 797 bp van gene was generated from forward and reverse sequence data using aligner software, USA. This van gene sequence was used to carry out BLAST with the NCBI genbank database (http://www.ncbi.nlm.nih.gov). Sequence showed 100 per cent similarity to E. gallinarum eS464 vanC1 vancomycin resistance gene (Accession no. EU151772.1).

Conventional biochemical tests identified a total of 95 enterococcal isolates, which were subjected to Vitek2 automated system identification that identified 93 as Enterococcus. The remaining two were identified as Leuconostoc mesenteroides spp cremoris and Pediococcus pentosaceous. Most of the isolates were from urine (88.17%, n=82) followed by five (5.38%) from pus, four (4.3%) from blood, one (1.08%) isolate each from CSF and duodenal aspirate. Majority of enterococcal isolates were from urine, similar to many studies done in India [2],[7],[8] . Speciation of the 93 enterococcus species by Vitek2 automated system was similar to that by conventional biochemical tests. [Table I] shows the species distribution of the Enterococcus species. E. faecalis was the commonest species (81.72%) isolated, followed by E. faecium (12.9%), which was similar to studies done elsewhere [9],[10],[11] . The other species isolated were E. raffinosus (3.23%, n=3), E. avium (1.08%, n=1) and E. gallinarum (1.08%, n=1) which have also been reported from India [10],[12],[13] . [Table II] shows the antibiotic susceptibility pattern of the enterococcal isolates. All 93 isolates were found to be resistant to penicillin. Many studies in India have reported resistance to penicillin in the range of 40-80 per cent [12],[13],[14] . A study by Jain et al[15] from north India has also reported penicillin resistance as 100 per cent. Ampicillin resistance was seen in 93.6 per cent isolates. This was a higher value as compared to many other studies [7],[13],[14] . Eighty two per cent urinary isolates were found to be sensitive to nitrofurantoin. A few studies have reported similar results [10],[16] . Nitrofurantoin is an excellent drug against enterococcal urinary tract infection and has been used for past many years. It is both bacteriostatic and bactericidal. No cross-resistance was seen between nitrofurantoin and any other antibiotic [9] . All isolates were found to be sensitive to teicoplanin and linezolid. High level gentamicin resistance (HLGR) and high level streptomycin resistance (HLSR) were found to be 53.76 and 33.33 per cent, respectively, similar to that reported earlier [2],[10] .
Table I. Species distribution of enterococcal isolates

Click here to view
Table II. Antibiotic susceptibility pattern of enterococcal isolates


Click here to view


In our study, 71 (76.34%) enterococcal isolates were from hospitalized patients, while only 22 (23.66%) were from outpatients. o0 f the 32 urinary isolates from inpatients with more than three days of hospital stay, 84.38 per cent (n=27) were catheterized on the day of admission, with no sign and symptom of urinary tract infection. Urinary tract infection by Enterococcus in catheterized patients was found to be significantly associated with more than 72 h of hospitalization (p0<0.01). Therefore, the enterococcal urinary tract infection in catheterized patients may be of nosocomial nature.

Though E. faecalis and E. faecium are more commonly isolated, we isolated E. gallinarum from the urine sample of a hospitalized patient, which is seldom isolated from clinical specimens. It was found to be resistant to vancomycin with MIC of 4 μg/ml and susceptible to teicoplanin and therefore, phenotype of glycopeptide resistance was of VanC (intrinsic resistance). The VanC phenotype, as found in E. gallinarum, E. casseliflavus, and E. flavescens, is characterized by intrinsic low-level resistance to vancomycin. The nucleotide sequences of the vanC-1 gene in E. gallinarum, the vanC-2 gene in E. casseliavus, and the vanC-3 gene in E. flavescens have been reported, although there is some disagreement as to whether E. flavescens is actually an enterococcal species [5] .

Though E. gallinarum is intrinsically resistant to vancomycin by virtue of Van C1 gene, determination of genotype is of utmost importance, as acquisition of other Van gene may confer high level vancomycin resistance to this species and subsequent transfer to other species as well. Presence of VanA gene along with vanC1 gene in E. gallinarum isolates has been reported [17] .

In conclusion, vancomycin resistance was not found to be a major resistance in enterococcal isolates in this area. All isolates were resistant to penicillin and high level aminoglycoside resistance in enterococcal isolates made this combination ineffective as treatment option for this infection. Use of vancomycin and linezolid can increase the selective pressure of these antibiotics in near future to form resistance. As an alternative, nitrofurantoin can be a better treatment option if found sensitive for the category of urinary infections in catheterized hospitalized patients.


   Acknowledgment Top


Authors acknowledge the financial grant received from the Department of Biotechnology, New Delhi, for the study.

Conflicts of Interest: None.

 
   References Top

1.
Moellering RC. Emergence of enterococcus as a significant pathogen. J Clin Infect Dis 1992; 14 : 1173-6.  Back to cited text no. 1
    
2.
Mathur P, Kapil A, Chandra R, Sharma P, Das B. Antimicrobial resistance in Enterococcus faecalis at a tertiary care centre of northern India. Indian J Med Res 2003; 118 : 25-8.  Back to cited text no. 2
    
3.
Facklam RR, Collins MD. Identification of Enterococcus species isolated from human infection by a conventional test scheme. J Clin Microbiol 1989; 27 : 731-4.  Back to cited text no. 3
[PUBMED]    
4.
Bauer AW, Kirby WM, Sherris JC, Turck M. Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathol 1966; 45 : 493-6.  Back to cited text no. 4
    
5.
Clinical and Laboratory Standards Institute (CLSI). Performance standards for antimicrobial susceptibility testing; 23 rd informational supplement. CLSI document M100- S23. Wayne PA. CLSI; 2013.  Back to cited text no. 5
    
6.
Clark NC, Teixeira LM, Facklam RR, Tenover FC. Detection and differentiation of vanC-1, vanC-2 and vanC-3 glycopeptide resistance genes in enterococci. J Clin Microbiol 1998; 36 : 2294-7.  Back to cited text no. 6
    
7.
Shrihari N, Kumudini TS, Karadesai SG, Metgud SC. Speciation of enterococcal isolates and antibiotic susceptibility test including high level aminoglycoside resistance and minimum inhibitory concentration for vancomycin. Int J Biol Med Res 2011; 2 : 865-9.  Back to cited text no. 7
    
8.
Palanisamy S, Karunakaran S, Narayanan S. Antimicrobial resistance profile and characterization of e0 nterococcus species from various clinical samples in a tertiary care hospital. Int J Med Res Health Sci 2013; 2 : 328-33.  Back to cited text no. 8
    
9.
Bose S, Ghosh AK, Barapatre R. Prevalence of drug resistance among Enterococcus spp isolated from a tertiary care hospital. Int J Med Health Sci 2012; 1 : 38-44.   Back to cited text no. 9
    
10.
Rahangdale VA, Agrawal G, Jalgaonkar SV. Study of antimicrobial resistance in enterococci. Indian J Med Microbiol 2008; 26 : 285-7.  Back to cited text no. 10
    
11.
Prakash VP, Rao SR, Parija SC. Emergence of unusual species of enterococci causing infections, South India. BMC Infect Dis 2005; 5 : 14.  Back to cited text no. 11
    
12.
Jada S, Jayakumar K. Prevalence of Enterococcus species from various clinical specimens in Shri Sathya Sai Medical College and Research institute with special reference to speciation & their resistance to vancomycin. Int J Med Clin Res 2012; 3 : 154-60.   Back to cited text no. 12
    
13.
Mulla S, Patel KG, Panwala T, Rewadiwala S. Prevalence of enterococci with higher resistance level in a tertiary care hospital: a matter of concern. Natl J Med Res 2012; 2 : 25-7.   Back to cited text no. 13
    
14.
Sreeja S, Babu PRS, Prathab AG. The prevalence and the characterization of the Enterococcus species from various clinical samples in a tertiary care hospital. J Clin Diagn Res 2012; 6 : 1486-8.  Back to cited text no. 14
    
15.
Jain S, Kumar A, Kashyap B, Kaur IR. Clinico-epidemiological profile and high level aminoglycoside resistance in enterococcal septicemia from a tertiary care hospital in east Delhi. Int J Appl Basic Med Res 2011; 1 : 80-3.   Back to cited text no. 15
    
16.
Gupta V, Singla N. Antibiotic susceptibility pattern of enterococci. J Clin Diagn Res 2007; 5 : 385-9.  Back to cited text no. 16
    
17.
Praharaj I, Sujatha S, Parija SC, Gopalakrishnan MS. Fatal meningitis caused by vancomycin resistant enterococci: report of two cases from south India. Indian J Med Microbiol 2012; 30 : 242-5  Back to cited text no. 17
    



 
 
    Tables

  [Table I], [Table II]



 

Top
 
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
   Acknowledgment
    References
    Article Tables

 Article Access Statistics
    Viewed705    
    Printed5    
    Emailed0    
    PDF Downloaded281    
    Comments [Add]    

Recommend this journal