Indan Journal of Medical Research Indan Journal of Medical Research Indan Journal of Medical Research Indan Journal of Medical Research
  Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login  
  Home Print this page Email this page Small font sizeDefault font sizeIncrease font size Users Online: 810       

   Table of Contents      
ORIGINAL ARTICLE
Year : 2015  |  Volume : 141  |  Issue : 1  |  Page : 55-61

Application of IS1311 locus 2 PCR-REA assay for the specific detection of 'Bison type' Mycobacterium avium subspecies paratuberculosis isolates of Indian origin


1 National JALMA Institute for Leprosy & Other Mycobacterial Diseases (ICMR), Agra, India
2 Canadian Food Inspection Agency, QC, Canada
3 Canadian Food Inspection Agency, QC, Canada; Amity Institute of Microbial Technology, Amity University Rajasthan, Kant Kalwar, NH-11C, Jaipur 303 002, Rajasthan, India, Canada
4 Central Institutes for Research on Goats, Mathura, India

Date of Submission22-Oct-2012
Date of Web Publication2-Apr-2015

Correspondence Address:
Devendra Singh Chauhan
Department of Microbiology & Molecular Biology, National JALMA Institute for Leprosy & Other Mycobacterial Diseases (ICMR), Agra 282 001, Uttar Pradesh
Canada
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0971-5916.154497

Rights and Permissions
   Abstract 

Background & objectives: Of the three major genotypes of Mycobacterium avium subspecies paratuberculosis (MAP), 'Bison type' is most prevalent genotype in the domestic livestock species of the country, and has also been recovered from patients suffering from Crohn's disease. Recently, a new assay based on IS1311 locus 2 PCR- restriction endonuclease analysis (REA) was designed to distinguish between 'Indian Bison type' and non-Indian genotypes. The present study investigated discriminatory potential of this new assay while screening of a panel of MAP isolates of diverse genotypes and from different geographical regions.
Methods: A total of 53 mycobacterial isolates (41 MAP and 12 mycobacterium other than MAP), three MAP genomic DNA and 36 MAP positive faecal DNA samples from different livestock species (cattle, buffaloes, goat, sheep and bison) and geographical regions (India, Canada, USA, Spain and Portugal) were included in the study. The extracted DNA samples (n=92) were analyzed for the presence of MAP specific sequences (IS900, ISMav 2 and HspX) using PCR. DNA samples were further subjected to genotype differentiation using IS1311 PCR-REA and IS1311 L2 PCR-REA methods.
Results: All the DNA samples (except DNA from non-MAP mycobacterial isolates) were positive for all the three MAP specific sequences based PCRs. IS1311 PCR-REA showed that MAP DNA samples of Indian origin belonged to 'Bison type'. Whereas, of the total 19 non-Indian MAP DNA samples, 2, 15 and 2 were genotyped as 'Bison type', 'Cattle type' and 'Sheep type', respectively. IS1311 L2 PCR-REA method showed different restriction profiles of 'Bison type' genotype as compared to non-Indian DNA samples.
Interpretation & conclusions: IS1311 L2 PCR-REA method successfully discriminated 'Indian Bison type' from other non-Indian genotypes and showed potential to be future epidemiological tool and for genotyping of MAP isolates.

Keywords: Genotypes - Indian bison type - IS1311 L2 PCR-REA - Mycobacterium avium subspecies paratuberculosis - paratuberculosis


How to cite this article:
Singh AV, Chauhan DS, Singh A, Singh PK, Sohal JS, Singh SV. Application of IS1311 locus 2 PCR-REA assay for the specific detection of 'Bison type' Mycobacterium avium subspecies paratuberculosis isolates of Indian origin. Indian J Med Res 2015;141:55-61

How to cite this URL:
Singh AV, Chauhan DS, Singh A, Singh PK, Sohal JS, Singh SV. Application of IS1311 locus 2 PCR-REA assay for the specific detection of 'Bison type' Mycobacterium avium subspecies paratuberculosis isolates of Indian origin. Indian J Med Res [serial online] 2015 [cited 2019 Aug 20];141:55-61. Available from: http://www.ijmr.org.in/text.asp?2015/141/1/55/154497

Mycobacterium avium subspecies paratuberculosis (MAP) is a cause of chronic granulomatous enteritis and lymphadinits (paratuberculosis or Johne's disease) in different species of animals [1] including primates [2] . Johne's disease (JD) is responsible for inflicting huge economic losses to the livestock industry worldwide due to reduced milk production, increased premature culling and mortality and reduced fertility [3] . MAP-infected animals (sub-clinical and clinical) shed live bacilli in faeces and milk, thereby increasing the risk of transmission to newborn and other susceptible animals. Recently MAP has also been shown to be associated with Crohn's disease [4],[5] in human beings. MAP escapes standard pasteurization temperatures, and, therefore, presence of live MAP bacilli in the milk supplies is of great concern and poses potential risk to human population [6],[7] .

Control of MAP infection is the priority of developed countries to secure animal productivity and to reduce chances of human exposure. Inspite of the availability of sensitive tests [8],[9] , 'Test and cull' method is not effective for the control of disease in livestock herds/flocks. Vaccination is considered as the method of choice for the control of JD in animals [10],[11] . However, efficacy of vaccines depends on the genotype of candidate strain used [11],[12] . Therefore, knowledge of the genotypes infecting domestic livestock species is critical for designing disease control strategies.

Based on IS1311 polymerase chain reaction-restriction endonuclease analysis (PCR-REA) method, MAP isolates have been grouped into three genetically distinct genotypes ('Cattle type', 'Sheep type' and 'Bison type) [13],[14] . Studies reported host preferences of these MAP geno-groups, however, host adaptation is not absolute and inter-species sharing of MAP genotypes has been reported [15] . 'Bison type' genotype was first reported from wild bison of Montana, USA [13] , and later similar genotypes have been reported as major genotypes infecting domestic livestock, wild ruminants and human population in India [16] . Recently, 'Bison type' genotype has also been reported from other regions of Asia (Korea) [17] and Africa (Uganda) [18] . We have earlier identified genomic variations in terms of genetic rearrangements, in-del polymorphisms and locus polymorphisms in 'Bison type' genotype of Indian origin when compared with genotypes reported from other parts of the world [19],[20] . Therefore, new nomenclature 'Indian Bison type' was assigned to 'native Bison type' genotype [20] . Another molecular signature (sequence variations of native genotype) was deletion of two base pairs (TG) at 64 th and 65 th positions of IS1311 element particularly at locus 2 as compared to non-Indian isolates [19],[20] . Taking the advantage of this molecular signature, a new IS1311 locus 2 specific PCR-REA (IS1311 L2 PCR-REA) assay was optimized for discrimination of 'Indian Bison type' from other isolates [21] . However, validation of this newly optimized assay was not done on a large panel of MAP isolates from different geographical regions of the world. The present study was carried out to investigate applicability of IS1311 L2 PCR-REA assay on samples of diverse genotypes (Cattle type, Sheep type and Bison type) and different geographical regions (India, Canada, USA, Spain and Portugal).


   Material & Methods Top


A total of 53 mycobacterial isolates (41 MAP and 12 mycobacteria other than MAP), three MAP genomic DNA and 36 MAP faecal DNA samples from different hosts and geographical regions were processed for the investigation of genomic variations using IS1311 PCR-REA and IS1311 L2 PCR-REA. The study was performed between August 2010 and July 2013 at the Department of Microbiology and Molecular Biology, National JALMA Institute for Leprosy and Other Mycobacterial Diseases (NJIL&OMD) located in Agra, Uttar Pradesh, India. Of the 41 MAP isolates, 25, 3, 2 and 11 were from India, Canada, Spain and USA, respectively ([Table 1]). Three MAP genomic DNA samples of Portugal origin (provided by Dr Maria Gazouli, School of Animal Science, Agricultural University, Athens, Greece) were also included in this study.
Table 1. Genotyping of MAP isolates/ DNA using IS1311 PCR-REA and locus 2 specific IS1311 PCR-REA method


Click here to view


MAP isolates (n=25) and faecal DNA samples

(n=36) of Indian origin were collected from epidemiological studies conducted in Agra, Mathura, Jhansi and hilly regions of northern India (data not shown). To check the specificity of IS1311 L2 PCR-REA, a total of 12 mycobacterial isolates other than MAP [M. smegmatis, M. vaccae, M. marinum, M. chelonae, M. flavescens, M.fortuitum, M. kansasii, M. bovis, M. bovis (BCG), M. avium,  M.gastri Scientific Name Search , M. indicus pranii] were obtained from mycobacterial repository, NJIL&OMD, Agra. All the mycobacterial isolates (n=53) were subjected to isolation of genomic DNA as per the method of van Soolingen et al[22]. DNA samples recovered from isolates and faecal samples were subjected to IS900[23] , ISMav2[24] and HspX[25] specific PCRs for the molecular identification of MAP.

IS1311 PCR-REA (Genotyping of isolates/DNA): Genotyping of each MAP DNA obtained from mycobacterial isolates or faecal samples was carried out by IS1311 PCR-REA method [14] . Briefly, reaction was carried out in 30 µl volume, containing 20 µl positive IS1311 PCR product, 3 µl 10X buffer (Fermentas, USA), 2 units of each endonuclease HinfI and MseI (Fermentas). Reaction mixture was incubated at 37 [0] C for 1.5 h. Band patterns were visualized after electrophoresis on 4 per cent high resolution agarose gel stained with ethidium bromide and genotype profile interpretation was done as described by Sevilla et al[14] .

IS1311 locus 2 PCR-REA (Sub-genotyping of MAP isolates): IS1311 L2 PCR-REA optimized by Sohal et al[21] was used to characterize all MAP isolates/faecal DNA included in this study. Firstly, locus 2 of IS1311 was amplified using the specific primers (P1: CACCAACCATGCAGAGGTAA; P2: GGAATCCGCAACTCCAAAT) and then amplicons were subjected to restriction digestion using BsaJ1. PCR reaction mix contained primers (10 pmoles), Taq polymerase (1 unit), MgCl 2 (1.5 mM), dNTPs (0.2 mM), buffer 10X (2.5 µl) and template DNA (5 ng) in a final volume of 25.0 µl at thermocycler conditions: denaturation at 95 °C for 5 min followed by 40 cycles of de-naturation at 95 °C for 30 sec, annealing at

55 °C at 30 sec, extension at 72 °C for 1 min followed final extension at 72 °C for 7 min. PCR products were visualized on 1.5 per cent agarose gel. Amplification products (~425 bp) were digested with BsaJI enzyme for 2 h at 37°C and band pattern was observed on 4 per cent agarose gel.

The study protocol was approved by the institute's ethical committee.


   Results Top


MAP specific IS900, ISMav 2 and HspX PCRs showed presence of MAP DNA in all samples ([Figure 1] [Figure 2] [Figure 3]) except those extracted from isolates of mycobacteria other than MAP.
Figure 1. Molecular identification of MAP isolates by using PCR targeting IS900 sequence (specific product size 229bp). Lane 1: 100bp marker; Lane 2: Positive control (Indian Bison type MAP S5), Lane 3: Negative control (deionized distilled water); Lane 4: isolates no. T7 (MAP positive); Lane 5: isolates no. 22G (MAP positive); Lane 6: isolates no. R27 (MAP positive); Lane 7: isolates no. MAP 16 (MAP positive); Lane 8: isolates no. MAP 18 (MAP positive), Lane 9: isolates no.W213 (MAP positive).

Click here to view
Figure 2. Molecular identification of MAP isolates by using PCR targeting ISMav02 sequence (specific product size 312 bp). Lane 1: 100bp marker; Lane 2: Negative control (deionized distilled water); Lane 3: Positive control (Indian Bison type MAP S5); Lane 4: isolates no.T7 (MAP positive); Lane 5: isolates no.22G (MAP positive); Lane 6: isolates no.R27 (MAP positive); Lane 7: isolates no.MAP 16 (MAP posi­tive); Lane 8: isolates no. MAP 18 (MAP positive), Lane 9: isolates no.W213 (MAP positive).

Click here to view
Figure 3. Molecular identification of MAP isolates using PCR targeting HspX sequence (Specific product size 211bp). Lane 1: 100bp marker; Lane 2: Negative control (deionized distilled water); Lane 3: Positive control (Indian Bison type MAP S5); Lane 4: isolates no.T7 (MAP positive); Lane 5: isolates no.22G (MAP positive); Lane 6: isolates no. R27 (MAP positive); Lane 7: isolates no. MAP 16 (MAP positive); Lane 8: isolates no. MAP 18 (MAP positive), Lane 9: isolates no.W213 (MAP positive).

Click here to view


IS1311 PCR-REA (Genotyping): Of the 80 MAP-DNA samples, 63, 15 and 2 showed the pattern of 'Bison type', 'Cattle type' and 'Sheep type' genotypes, respectively (Table, [Figure 4]). All MAP DNA samples of Indian origin belonged to 'Bison type'. Of the three isolates of Canada, one each was genotyped as 'Cattle type', 'Sheep type' and 'Bison type'. Of the 11 isolates of USA origin, one and 10 were genotyped as 'Bison type' and Cattle type, respectively. Of the two isolates from Spain, one was 'Cattle type' and another was identified as 'Sheep type', whereas, all three isolates of Portugal origin were identified as 'Cattle type' (Table).
Figure 4. Genotyping of MAP isolates using IS1311 polymerase chain reaction-restriction endonuclease analysis. Lane 1: 100bp ladder; Lane 2: isolates no. MAP16 (Bison type of Indian origin); Lane 3: isolates no.429 (Cattle type of Spain origin); Lane 4: isolates no. B1 (Bison type of Canada origin); Lane 5: isolates no.W213 (Cattle type of USA origin); Lane 6: isolates no.22G (Sheep type of Spain origin), Lane 7: isolates no.MAPS1 (Sheep type of Canada origin), Lane 8: 100 bp DNA ladder.

Click here to view


IS1311 L2 PCR-REA (Sub-genotyping): Restriction profile and band pattern for marker IS1311 L2 PCR-REA distinguished 'Bison type' DNA of Indian origin from all non-Indian MAP samples (Table, [Figure 5]). After restriction digestion of ~425 bp product (belonging to IS1311 element at locus 2) with BsaJI enzyme, four digestion products were visualized in the 4 per cent high resolution agarose gel (34, 67, 78 & 230 bp) for non-Indian MAP. However, digestion of IS1311 locus 2 amplicon of MAP DNA of Indian origin resulted into only three detectable bands in the gel (67, 78 &

262 bp).
Figure 5. Discriminatory restriction pattern of representative MAP isolates of Indian and non-Indian origin using IS1311 PCR locus 2-REA method. Lane 1 Marker (50bp); Lane 2: Negative control, Lane 3: Undigested PCR product (~425bp); Lane 4: isolates no. W213 (Cattle type of USA origin); Lane 5: isolates no. 22G (Sheep type of Spain origin); Lane 6: isolates no. MAP B1 (Bison type of Canada origin); Lane 7: isolates no. MAP 16 (Bison type of Indian origin); Lane 8: isolates no. MAP 18 (Bison type of Indian origin).

Click here to view


On evaluating the specificity of IS1311 L2 PCR-REA on 12 non-MAP mycobacterial DNA, none were amplified except DNA of M. avium. However, the restriction profile of M. avium was different to that of MAP.


   Discussion Top


Molecular epidemiology of MAP has been poorly understood due to slow growth of the pathogen in artificial medium. r0 apid strain differentiation methods are pre-requisite to understand the origin of infection, disease transmission and to design disease control strategies. In the present study, IS1311 PCR-REA method was applied on MAP isolates/DNA from India, Canada, USA, Spain and Portugal, and MAP positive faecal DNA samples of domestic ruminants of north India for determining the genotype. Further, potential of recently described IS1311 PCR L2 PCR-REA method was evaluated for genomic marker based differentiation between Indian and non-Indian strains.

In the present study, genomic and faecal DNA samples obtained from MAP infected animals of north India were genotyped as Bison type. These results were similar to that reported in previous epidemiological investigations conducted in north India [16] , and 'Bison type' genotype was identified as the dominant genotype. Contrary to the present study, 'Cattle type' genotype of MAP was found as predominant genotype infecting domestic livestock, wild ruminant and non-ruminant species in other countries [17],[26] . 'Sheep type' strains are rarely associated with paratuberculosis in species other than sheep [15],[27] . In present study, we could not detect any 'Cattle type' and 'Sheep type' genotype of MAP in animals from north India. Previously 'Cattle type' strains have been reported from cattle and human population of northern India [16] .

The results showed that new IS1311 L2 PCR-REA assay successfully discriminated 'Bison type' genotype of Indian origin ('Indian Bison type') from MAP isolates of other genotypes (Cattle type, Sheep type and Bison type) of non-Indian origin. The test was found to be very specific as all mycobacterial isolates (except M. avium) other than MAP could not be amplified by the MAP specific primers. Due to high genetic similarity between M. avium and MAP, IS1311 L2 PCR amplified the DNA of both. However, the restriction profiles of IS1311 locus 2 by BsaJ1 restriction enzyme were different between both species. The present finding confirmed that 'TG' gap deletion at 64 th and 65 th position of IS1311 element at locus 2 was a stable marker and could be used in future strain typing as 'Molecular signature' and in epidemiological investigations. This newly optimized tool successfully worked on the clinical DNA samples obtained from faecal samples of MAP infected animals. Further, this assay can give results much faster (1 day) than culture based typing methods (i.e. RFLP or PFGE) and is particularly suitable in conditions where we may have culture negative results.

In conclusion, our study demonstrates that IS1311 L2 PCR-REA assay is a rapid, and easy to perform method for the differentiation of 'Bison type' MAP isolates of Indian origin from non-Indian MAP isolates of different genotypes. MAP is an important livestock pathogen world over which besides inviting trade restrictions, is a potential human pathogen.


   Acknowledgment Top


Authors acknowledge the Indian Council of Agricultural Research, New Delhi, for financial support and Indian Council of Medical Research, New Delhi for Post Doctoral Fellowship to the first and the fourth authors (AVS and PKS). Authors thank

Dr R.A. Juste, NEIKER, Spain; Dr Maria Gazouli, School of Animal Science, Agricultural University, Athens, Greece and Dr M.T. Collins, School of Veterinary Medicine, University of Wisconsin, Madison, for providing M. avium subsp. paratuberculosis isolates/DNA samples.

 
   References Top

1.
Harris NB, Barletta RG. Mycobacterium avium subsp. paratuberculosis in Veterinary Medicine. Clin Microbiol Rev 2001; 14 : 489-512.  Back to cited text no. 1
    
2.
McClure HM, Chiodini RJ, Anderson DC, Swenson RB, Thayer WR, Coutu JA. Mycobacterium paratuberculosis infection in a colony of stumptail macaques (Macaca arctoides). J Infect Dis 1987; 155 : 1011-9.  Back to cited text no. 2
[PUBMED]    
3.
Hasonova L, Pavlik I. Economic impact of paratuberculosis in dairy cattle herds: a review. Vet Med Czech 2006; 51 : 193-211.  Back to cited text no. 3
    
4.
Pierce ES. Where are all the Mycobacterium avium subspecies paratuberculosis in patients with Crohn's disease? PLoS Pathog 2009; 5 : e1000234.  Back to cited text no. 4
    
5.
Wynne JW, Bull TJ, Seemann T, Bulach DM, Wagner J, Kirkwood CD, et al. Exploring the zoonotic potential of Mycobacterium avium subspecies paratuberculosis through comparative genomics. PLoS o0 ne 2011; 6 : e22171.  Back to cited text no. 5
    
6.
Grant IR, Ball HJ, Rowe MT. Incidence of Mycobacterium paratuberculosis in bulk raw and commercially pasteurized cows' milk from approved dairy processing establishments in the United Kingdom. Appl Environ Microbiol 2002; 68 : 2428-35.  Back to cited text no. 6
    
7.
Shankar H, Singh SV, Singh PK, Singh AV, Sohal JS, Greenstein RJ. Presence characterization and genotype profiles of Mycobacterium avium subspecies paratuberculosis from unpasteurized individual and pooled milk, commercial pasteurized milk and milk products in India by culture, ELISA, PCR and PCR-REA methods. Int J Infect Dis 2010; 14 : 121-6.  Back to cited text no. 7
    
8.
Wadhwa A, Bannantine JP, Byrem TM, Stein TL, Saxton AM, Speer CA, et al. Optimization of serum EVELISA for milk testing of Johne's disease. Foodborne Patho Dis 2012; 9 : 749-54.  Back to cited text no. 8
    
9.
Singh SV, Singh PK, Kumar H, Sohal JS, Singh AV. Evaluation of blood PCR with blood culture, ELISA and microscopic examination for the diagnosis of Mycobacterium avium subspecies paratuberculosis infection in goat kids. Indian J Small Rumin 2010; 16 : 67-73.  Back to cited text no. 9
    
10.
Perez V, Garcia Marin JF, Bru R, Moreno B, Badiola JJ. Results of a paratuberculosis vaccination trial in adult sheep. Med Vet 1995; 12 : 196-201.  Back to cited text no. 10
    
11.
Singh SV, Singh PK, Singh AV, Sohal JS, Gupta VK. Comparative efficacy of an indigenous 'Inactivated vaccine' using highly pathogenic field strain of Mycobacterium avium subspecies paratuberculosis 'Bison type' with a commercial vaccine for the control of Capri - Paratuberculosis in India. Vaccine 2007; 25 : 7102-10.  Back to cited text no. 11
    
12.
Uzonna JE, Chilton P, Whitlock RH, Habecker PL, Scott P, Sweeney RW. Efficacy of commercial and field-strain Mycobacterium paratuberculosis vaccinations with recombinant IL-12 in a bovine experimental infection model. Vaccine 2003; 21 : 3101-9.  Back to cited text no. 12
    
13.
Whittington RJ, Marsh IB, Whitlock RH. Typing of IS1311 polymorphisms confirms that bison (Bison bison) with paratuberculosis in Montana are infected with a strain of Mycobacterium avium subsp. paratuberculosis distinct from that occurring in cattle and other domestic livestock. Mol Cell Probes 2001; 15 : 139-45.   Back to cited text no. 13
    
14.
Sevilla I, Singh SV, Garrido JM, Aduriz G, Rodriguez S, Geijo MV, et al. Molecular typing of Mycobacterium avium subspecies paratuberculosis strains from different hosts and regions. Rev Sci Tech Rev 2005; 24 : 1061-6.  Back to cited text no. 14
    
15.
Stevenson K, Alvarez J, Bakker D, Biet F, de Juan L, Denham S, et al. Occurrence of Mycobacterium avium subspecies paratuberculosis across host species and European countries with evidence for transmission between wildlife and domestic ruminants. BMC Microbiol 2009; 9 : 212.  Back to cited text no. 15
    
16.
Singh SV, Sohal JS, Singh PK, Singh AV. Genotype profiles of Mycobacterium avium subspecies paratuberculosis isolates recovered from animals, commercial milk and human beings in North India. Int J Infect Dis 2009; 13 : 221-7.  Back to cited text no. 16
    
17.
Kim JM, Ku BK, Lee HN, Jang YB, Her M, Kim JW, et al. Mycobacterium avium subsp. paratuberculosis in wild boards from Korea. In: International Association for Paratuberculosis (Ed.), Proceedings of the 11 th International Colloquium on Paratuberculosis. Sydney, Australia; 2012. p. 175.  Back to cited text no. 17
    
18.
Okuni JB, Dovas CI, Loukopoulos P, Bouzalas IG, Kateete DP, Joloba ML, et al. Isolation of Mycobacterium avium subspecies paratuberculosis from Ugandan cattle and strain differentiation using optimised DNA typing techniques. BMC Vet Res 2012; 8 : 99.  Back to cited text no. 18
    
19.
Sohal JS, Sheoran N, Narayanasamy K, Brahmachari V, Singh S, Subodh S. Genomic analysis of local isolate of Mycobacterium avium subspecies paratuberculosis. Vet Microbiol 2009; 134 : 375-82.  Back to cited text no. 19
    
20.
Sohal JS, Singh SV, Singh PK, Singh AV. On the evolution of 'Indian Bison type' Mycobacterium avium subspecies paratuberculosis. Microbiol Res 2010; 165 :163-71.  Back to cited text no. 20
    
21.
Sohal JS, Singh SV, Singh PK, Singh AV, Kumar N. A new marker IS 1311 L2 PCR-REA for identification of 'Indian Bison Type' Mycobacterium avium subspecies paratuberculosis. Indian J Biotech 2013; 12 : 204-7.   Back to cited text no. 21
    
22.
van Soolingen D, Hermans PW, de Haas PE, Soll DR, van Embden JD. Occurrence and stability of insertion sequences in Mycobacterium tuberculosis complex strains: evaluation of an insertion sequence-dependent DNA polymorphism as a tool in the epidemiology of tuberculosis. J Clin Microbiol 1991; 29 : 2578-86.  Back to cited text no. 22
    
23.
Vary PH, Andersen PR, Green E, Hermon-Taylor J, McFadden JJ. Use of highly specific DNA probes and the polymerase chain reaction to detect Mycobacterium paratuberculosis in Johne's disease. J Clin Microbiol 1990; 28 : 933-7.  Back to cited text no. 23
    
24.
Mobius P, Hotzel H, Rassbach A, Kohler H. Comparison of 13 single-round and nested PCR assays targeting IS900, ISMav2, f57 and locus 255 for detection of Mycobacterium avium subsp. paratuberculosis. Vet Microbiol 2008; 126 : 324-33.  Back to cited text no. 24
    
25.
Ellingson JLE, Stabel JR, Radcliff RP, Whitlock RH, Miller JM. Detection of Mycobacterium avium subspecies paratuberculosis in free-ranging bison (Bison bison) by PCR. Mol Cell Probes 2005; 19 : 219-25.  Back to cited text no. 25
    
26.
Motiwala AS, Li L, Kapur V, Sreevatsan S. Current understanding of the genetic diversity of Mycobacterium avium subsp. paratuberculosis. Microbes Infect 2006; 8 : 1406-18.   Back to cited text no. 26
    
27.
Sevilla I, Garrido J, Geijo M, Juste R. Pulsed-field gel electrophoresis profile homogeneity of Mycobacterium avium subsp. paratuberculosisisolates from cattle and heterogeneity of those from sheep and goats. BMC Microbiol 2007; 7 : 12.  Back to cited text no. 27
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5]
 
 
    Tables

  [Table 1]


This article has been cited by
1 First molecular typing of Mycobacterium avium subspecies paratuberculosis identified in animal and human drinking water from dairy goat farms in Brazil
I.F. Espeschit,M.C.C. Souza,M.C. Lima,M.A.S. Moreira
Brazilian Journal of Microbiology. 2017;
[Pubmed] | [DOI]
2 Assessment of Ovine Johne???s disease in the Mandya sheep breed in South India using multiple diagnostic tests and bio-typing of Mycobacterium avium subspecies paratuberculosis infection
Shivalingappa Yamanappa Mukartal,Doddamane Rathnamma,Hogalagere Doddappaiah Narayanaswamy,Saurabh Gupta,Kundan Kumar Chaubey,Manju Singh,Zahra Hemati,Chikkahonnaiah Nishanth,Anjali Pachoori,Kuldeep Dhama,ShoorVir Singh,Pedro Gonz??lez-Redondo
Cogent Food & Agriculture. 2017; 3(1)
[Pubmed] | [DOI]
3 Concurrent Resolution of Chronic Diarrhea Likely Due to Crohn’s Disease and Infection with Mycobacterium avium paratuberculosis
Shoor V. Singh,J. Todd Kuenstner,William C. Davis,Prabhat Agarwal,Naveen Kumar,Devendra Singh,Saurabh Gupta,Kundan K. Chaubey,Ashok Kumar,Jyoti Misri,Sujatha Jayaraman,Jagdip S. Sohal,Kuldeep Dhama
Frontiers in Medicine. 2016; 3
[Pubmed] | [DOI]
4 Molecular typing of Mycobacterium avium subsp. paratuberculosis (MAP) isolated from dairy goats in Brazil
Marina de Castro Campos de Souza,Magna Coroa Lima,Isis de Freitas Espeschit Braga,David Germano Gonçalves Schwarz,Ana Paula de Souza Rodrigues,Erica Bravo Sales,Antônio Augusto Fonseca Junior,Maria Aparecida Scatamburlo Moreira
Small Ruminant Research. 2016; 140: 18
[Pubmed] | [DOI]



 

Top
 
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
    Abstract
   Material & Methods
   Results
   Discussion
   Acknowledgment
    References
    Article Figures
    Article Tables

 Article Access Statistics
    Viewed725    
    Printed13    
    Emailed0    
    PDF Downloaded243    
    Comments [Add]    
    Cited by others 4    

Recommend this journal